RchiOBHm_Chr7g0187161
ERF Family

Belongs to the ABC transporter superfamily. ABCG family. PDR (TC 3.A.1.205) subfamily

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
6939442 .. 6942745
3304 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ16706

Sequence Viewer

Length: 177 bp
ATGCTTTTCGCTTTGGGGGGCTTTGTCCTGTCAAGAGAAAATATAAAGAAATGGTGGATATGGGGCTACTGGATATCACCTTTGATGTATGGGCAGAATGCAATTGTAGTTAATGAATTCCTTGGCAAGAGTTGGTCACATGTAAGTGGTGTCGCCTTTAGCAAGCACACAATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

58

Amino Acids

6.7

Weight (kDa)

9.7

Isoelectric Point (pI)

22.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ABC2_membrane PF01061 1 - 40 1.9e-10 ABC-2 type transporter
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000652)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 116
AflIII ACRYGT 1 cut(s) 139
ApoI RAATTY 1 cut(s) 116
AsuHPI GGTGA 1 cut(s) 69
BsaJI CCNNGG 1 cut(s) 121
Bse1I ACTGG 1 cut(s) 74
BseDI CCNNGG 1 cut(s) 121
BseNI ACTGG 1 cut(s) 74
BsmI GAATGC 1 cut(s) 103
BsrI ACTGG 1 cut(s) 74
BssECI CCNNGG 1 cut(s) 121
BssT1I CCWWGG 1 cut(s) 121
BstC8I GCNNGC 1 cut(s) 164
BstNSI RCATGY 1 cut(s) 143
Cac8I GCNNGC 1 cut(s) 164
CviAII CATG 1 cut(s) 140
CviJI RGCY 2 cut(s) 21, 66
CviKI_1 RGCY 2 cut(s) 21, 66
Eco130I CCWWGG 1 cut(s) 121
Eco32I GATATC 1 cut(s) 75
EcoRI GAATTC 1 cut(s) 116
EcoRV GATATC 1 cut(s) 75
EcoT14I CCWWGG 1 cut(s) 121
ErhI CCWWGG 1 cut(s) 121
FaeI CATG 1 cut(s) 143
FaiI YATR 4 cut(s) 44, 61, 90, 141
FatI CATG 1 cut(s) 139
Hin1II CATG 1 cut(s) 143
HphI GGTGA 1 cut(s) 69
Hpy188III TCNNGA 1 cut(s) 33
HpyCH4V TGCA 1 cut(s) 101
Hsp92II CATG 1 cut(s) 143
LpnPI CCDG 2 cut(s) 41, 55
MaeIII GTNAC 1 cut(s) 135
MfeI CAATTG 1 cut(s) 102
MluCI AATT 3 cut(s) 102, 116, 171
MseI TTAA 2 cut(s) 111, 175
MslI CAYNNNNRTG 1 cut(s) 144
MunI CAATTG 1 cut(s) 102
Mva1269I GAATGC 1 cut(s) 103
NlaIII CATG 1 cut(s) 143
NmuCI GTSAC 1 cut(s) 135
NspI RCATGY 1 cut(s) 143
PciI ACATGT 1 cut(s) 139
PctI GAATGC 1 cut(s) 103
PscI ACATGT 1 cut(s) 139
RseI CAYNNNNRTG 1 cut(s) 144
SaqAI TTAA 2 cut(s) 111, 175
SetI ASST 1 cut(s) 82
SgeI CNNG 6 cut(s) 40, 45, 82, 134, 139, 152
SmiMI CAYNNNNRTG 1 cut(s) 144
Sse9I AATT 3 cut(s) 102, 116, 171
StyI CCWWGG 1 cut(s) 121
TasI AATT 3 cut(s) 102, 116, 171
Tru1I TTAA 2 cut(s) 111, 175
Tru9I TTAA 2 cut(s) 111, 175
TseFI GTSAC 1 cut(s) 135
Tsp45I GTSAC 1 cut(s) 135
TspDTI ATGAA 1 cut(s) 129
XapI RAATTY 1 cut(s) 116
XceI RCATGY 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.