Rmu_sc0013772.1_g000009
ERF Family

Belongs to the ABC transporter superfamily. ABCG family. PDR (TC 3.A.1.205) subfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013772.1
Physical Location & Seq
Reverse (-)
23649 .. 24864
1216 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013772.1_g000009.1.cds

Sequence Viewer

Length: 717 bp
atgatatttataggttcagatccgccttcttttggctatcagttaagacataggagaggaaaatcagaaactactcgtgctcagtacataaacacacaggatgtgaggctgacaataagcacttggaatgttgctggaggagttccggatgaaaaccttgatattgatgattggatttcttcaaaagagccatcggatatctacatgttcaatggaatggcagagctttcgatgactatagccaagcttccagtgttttataagcacagaaagctgctcttctttccaccatgggcatatgcccttccgacatggcttctcaagatccctctcacctgtgttgaagttggtgtttgggcaataccttctcctcctactcatgaatcaactggattattccgattcattgctggagcaggtagaagcttgactgttgctaatacatttggctcatttgcagtagtcatgctttcactttggggggctttgtcctgtcaagagaatgcaattgtagttaatgaattccttggcaagagttggtcacatgttcttccaaactcaaacgaatcattaggagttgaaattctgaaatctcatggatttcgtatgcatgcatattggtattggattggcgcaggagcattggctggatacatgctcttattcaacatttgttacactctggctctcacttatctaaaccgtgaagcaatctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

238

Amino Acids

26.72

Weight (kDa)

7.01

Isoelectric Point (pI)

35.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000652)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 261
Acc36I ACCTGC 1 cut(s) 407
AccIII TCCGGA 1 cut(s) 145
AciI CCGC 1 cut(s) 23
AclWI GGATC 2 cut(s) 14, 319
AcsI RAATTY 2 cut(s) 521, 582
AfaI GTAC 1 cut(s) 86
AfiI CCNNNNNNNGG 1 cut(s) 32
AflIII ACRYGT 2 cut(s) 204, 544
AgsI TTSAA 5 cut(s) 183, 211, 344, 581, 667
AluBI AGCT 4 cut(s) 226, 247, 274, 426
AluI AGCT 4 cut(s) 226, 247, 274, 426
Alw21I GWGCWC 1 cut(s) 82
AlwI GGATC 2 cut(s) 14, 319
Aor13HI TCCGGA 1 cut(s) 145
ApeKI GCWGC 1 cut(s) 274
ApoI RAATTY 2 cut(s) 521, 582
AspLEI GCGC 1 cut(s) 635
AsuHPI GGTGA 1 cut(s) 325
BauI CACGAG 1 cut(s) 75
Bbv12I GWGCWC 1 cut(s) 82
BbvI GCAGC 1 cut(s) 261
BccI CCATC 1 cut(s) 199
BcgI CGANNNNNNTGC 2 cut(s) 210, 244
BciVI GTATCC 1 cut(s) 644
BfaI CTAG 1 cut(s) 715
BfmI CTRYAG 1 cut(s) 237
BfuAI ACCTGC 1 cut(s) 407
BfuI GTATCC 1 cut(s) 644
BisI GCNGC 1 cut(s) 275
BlsI GCNGC 1 cut(s) 276
BpmI CTGGAG 2 cut(s) 156, 432
BpuEI CTTGAG 1 cut(s) 305
BsaJI CCNNGG 2 cut(s) 290, 526
BsaWI WCCGGW 1 cut(s) 145
Bsc4I CCNNNNNNNGG 1 cut(s) 32
Bse1I ACTGG 2 cut(s) 251, 394
Bse3DI GCAATG 1 cut(s) 405
BseAI TCCGGA 1 cut(s) 145
BseDI CCNNGG 2 cut(s) 290, 526
BseGI GGATG 2 cut(s) 106, 154
BseLI CCNNNNNNNGG 1 cut(s) 32
BseMI GCAATG 1 cut(s) 405
BseMII CTCAG 1 cut(s) 95
BseNI ACTGG 2 cut(s) 251, 394
BseRI GAGGAG 2 cut(s) 153, 360
BseXI GCAGC 1 cut(s) 261
BsiHKAI GWGCWC 1 cut(s) 82
BsiSI CCGG 1 cut(s) 146
BslI CCNNNNNNNGG 1 cut(s) 32
BsmI GAATGC 1 cut(s) 508
Bsp1286I GDGCHC 1 cut(s) 82
Bsp13I TCCGGA 1 cut(s) 145
Bsp143I GATC 2 cut(s) 19, 324
Bsp19I CCATGG 1 cut(s) 290
BspACI CCGC 1 cut(s) 23
BspCNI CTCAG 1 cut(s) 94
BspEI TCCGGA 1 cut(s) 145
BspHI TCATGA 1 cut(s) 379
BspMI ACCTGC 1 cut(s) 407
BspPI GGATC 2 cut(s) 14, 319
BspQI GCTCTTC 1 cut(s) 284
BsrDI GCAATG 1 cut(s) 405
BsrI ACTGG 2 cut(s) 251, 394
BssECI CCNNGG 2 cut(s) 290, 526
BssMI GATC 2 cut(s) 19, 324
BssSI CACGAG 1 cut(s) 75
BssT1I CCWWGG 2 cut(s) 290, 526
Bst2BI CACGAG 1 cut(s) 75
Bst4CI ACNGT 2 cut(s) 433, 704
Bst6I CTCTTC 1 cut(s) 284
BstC8I GCNNGC 1 cut(s) 612
BstDEI CTNAG 1 cut(s) 81
BstDSI CCRYGG 1 cut(s) 290
BstF5I GGATG 2 cut(s) 106, 154
BstHHI GCGC 1 cut(s) 635
BstKTI GATC 2 cut(s) 22, 327
BstMBI GATC 2 cut(s) 19, 324
BstMWI GCNNNNNNNGC 1 cut(s) 271
BstNSI RCATGY 4 cut(s) 208, 548, 614, 658
BstSFI CTRYAG 1 cut(s) 237
BstV1I GCAGC 1 cut(s) 261
BstX2I RGATCY 2 cut(s) 19, 324
BstYI RGATCY 2 cut(s) 19, 324
BsuI GTATCC 1 cut(s) 644
BtgI CCRYGG 1 cut(s) 290
BtsCI GGATG 2 cut(s) 106, 154
BtsIMutI CAGTG 1 cut(s) 258
BveI ACCTGC 1 cut(s) 407
Cac8I GCNNGC 1 cut(s) 612
CciI TCATGA 1 cut(s) 379
CfoI GCGC 1 cut(s) 635
Csp6I GTAC 1 cut(s) 85
CviAII CATG 9 cut(s) 205, 291, 312, 380, 466, 545, 596, 611, 655
CviQI GTAC 1 cut(s) 85
DdeI CTNAG 1 cut(s) 81
DpnI GATC 2 cut(s) 21, 326
DpnII GATC 2 cut(s) 19, 324
Eam1104I CTCTTC 1 cut(s) 284
EarI CTCTTC 1 cut(s) 284
EciI GGCGGA 1 cut(s) 12
Eco130I CCWWGG 2 cut(s) 290, 526
Eco32I GATATC 1 cut(s) 199
EcoRI GAATTC 1 cut(s) 521
EcoRV GATATC 1 cut(s) 199
EcoT14I CCWWGG 2 cut(s) 290, 526
EcoT22I ATGCAT 2 cut(s) 612, 616
ErhI CCWWGG 2 cut(s) 290, 526
FaeI CATG 9 cut(s) 208, 294, 315, 383, 469, 548, 599, 614, 658
FalI AAGNNNNNCTT 2 cut(s) 263, 295
FatI CATG 9 cut(s) 204, 290, 311, 379, 465, 544, 595, 610, 654
FauNDI CATATG 1 cut(s) 298
Fnu4HI GCNGC 1 cut(s) 275
FokI GGATG 2 cut(s) 113, 161
Fsp4HI GCNGC 1 cut(s) 275
FspBI CTAG 1 cut(s) 715
GlaI GCGC 1 cut(s) 634
GluI GCNGC 1 cut(s) 275
GsuI CTGGAG 2 cut(s) 156, 432
HapII CCGG 1 cut(s) 146
HhaI GCGC 1 cut(s) 635
Hin1II CATG 9 cut(s) 208, 294, 315, 383, 469, 548, 599, 614, 658
Hin6I GCGC 1 cut(s) 633
HinP1I GCGC 1 cut(s) 633
HindIII AAGCTT 2 cut(s) 245, 424
HinfI GANTC 3 cut(s) 383, 402, 566
HpaII CCGG 1 cut(s) 146
HphI GGTGA 1 cut(s) 325
Hpy188I TCNGA 6 cut(s) 19, 67, 196, 309, 401, 588
Hpy188III TCNNGA 4 cut(s) 146, 322, 380, 497
HpyAV CCTTC 3 cut(s) 36, 314, 375
HpyCH4III ACNGT 2 cut(s) 433, 704
HpyCH4V TGCA 4 cut(s) 458, 506, 610, 614
HpyF10VI GCNNNNNNNGC 1 cut(s) 271
HpyF3I CTNAG 1 cut(s) 81
Hsp92II CATG 9 cut(s) 208, 294, 315, 383, 469, 548, 599, 614, 658
HspAI GCGC 1 cut(s) 633
Kpn2I TCCGGA 1 cut(s) 145
Kzo9I GATC 2 cut(s) 19, 324
LguI GCTCTTC 1 cut(s) 284
LmnI GCTCC 2 cut(s) 413, 638
Lsp1109I GCAGC 1 cut(s) 261
MaeI CTAG 1 cut(s) 715
MaeIII GTNAC 2 cut(s) 540, 674
MalI GATC 2 cut(s) 21, 326
MboI GATC 2 cut(s) 19, 324
MboII GAAGA 3 cut(s) 171, 271, 542
MfeI CAATTG 1 cut(s) 507
MflI RGATCY 2 cut(s) 19, 324
MhlI GDGCHC 1 cut(s) 82
MluCI AATT 3 cut(s) 507, 521, 582
MmeI TCCRAC 1 cut(s) 332
MnlI CCTC 5 cut(s) 50, 99, 131, 339, 381
Mph1103I ATGCAT 2 cut(s) 612, 616
MroI TCCGGA 1 cut(s) 145
MseI TTAA 2 cut(s) 44, 516
MspI CCGG 1 cut(s) 146
MunI CAATTG 1 cut(s) 507
Mva1269I GAATGC 1 cut(s) 508
MwoI GCNNNNNNNGC 1 cut(s) 271
NcoI CCATGG 1 cut(s) 290
NdeI CATATG 1 cut(s) 298
NdeII GATC 2 cut(s) 19, 324
NlaIII CATG 9 cut(s) 208, 294, 315, 383, 469, 548, 599, 614, 658
NmuCI GTSAC 1 cut(s) 540
NsiI ATGCAT 2 cut(s) 612, 616
NspI RCATGY 4 cut(s) 208, 548, 614, 658
PaeI GCATGC 1 cut(s) 614
PagI TCATGA 1 cut(s) 379
PciI ACATGT 2 cut(s) 204, 544
PciSI GCTCTTC 1 cut(s) 284
PctI GAATGC 1 cut(s) 508
PfeI GAWTC 3 cut(s) 383, 402, 566
PkrI GCNGC 1 cut(s) 276
PscI ACATGT 2 cut(s) 204, 544
PsiI TTATAA 1 cut(s) 261
PsuI RGATCY 2 cut(s) 19, 324
RsaI GTAC 1 cut(s) 86
RsaNI GTAC 1 cut(s) 85
SapI GCTCTTC 1 cut(s) 284
SaqAI TTAA 2 cut(s) 44, 516
SatI GCNGC 1 cut(s) 275
Sau3AI GATC 2 cut(s) 19, 324
SduI GDGCHC 1 cut(s) 82
SetI ASST 9 cut(s) 16, 159, 228, 249, 276, 338, 367, 421, 428
SfcI CTRYAG 1 cut(s) 237
SmlI CTYRAG 1 cut(s) 320
SmoI CTYRAG 1 cut(s) 320
SphI GCATGC 1 cut(s) 614
Sse9I AATT 3 cut(s) 507, 521, 582
SsiI CCGC 1 cut(s) 23
SspMI CTAG 1 cut(s) 715
StyI CCWWGG 2 cut(s) 290, 526
TaaI ACNGT 2 cut(s) 433, 704
TaqI TCGA 1 cut(s) 230
TasI AATT 3 cut(s) 507, 521, 582
TatI WGTACW 1 cut(s) 84
TfiI GAWTC 3 cut(s) 383, 402, 566
Tru1I TTAA 2 cut(s) 44, 516
Tru9I TTAA 2 cut(s) 44, 516
TscAI CASTG 1 cut(s) 258
TseFI GTSAC 1 cut(s) 540
TseI GCWGC 1 cut(s) 274
Tsp45I GTSAC 1 cut(s) 540
TspDTI ATGAA 4 cut(s) 165, 394, 396, 534
TspRI CASTG 1 cut(s) 258
XapI RAATTY 2 cut(s) 521, 582
XceI RCATGY 4 cut(s) 208, 548, 614, 658
XspI CTAG 1 cut(s) 715
Zsp2I ATGCAT 2 cut(s) 612, 616
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.