RchiOBHm_Chr3g0490291

Vinorine synthase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0000622
Physical Location & Seq
Reverse (-)
36988565 .. 36989218
654 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ45347

Sequence Viewer

Length: 336 bp
ATGGACAAGATTGACAATCACTACACGAAAGGTCTACAACAAGGTGCTGAGCACTTGAGTGAGCTTAATGAAAGTGTTGATAGAGTTATCAGTGGAGAGCTGATTACATTTAGCTTCAGTAGTTTCTGCAGATTTCCTCTGTATGATAATGATTTTGGTTGGGGGAAGCCTACGTGGGTATCGTCATCACCACTGACCTTCAAGAACCTAGTGGTTTTCATGGATACCAAAGAGGCTGATGGAATAGAGGCATGTATTAGTTTGGAGGAGGAAGTCATGGTTAAGTTTGAAACTGATATCGAGTTTTTGGCTTATGCGTCTCCAAGTGGGTGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00940 ko00941 ko00945 ko01100 ko01110 map00940 map00941 map00945 map01100 map01110
Pfam Domains
Protein Families
Transferase

Protein Analysis

111

Amino Acids

12.5

Weight (kDa)

4.34

Isoelectric Point (pI)

47.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Transferase PF02458 6 - 102 2.8e-16 Transferase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000622)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g24710 FvH4_4g24720 FvH4_4g24770 FvH4_4g24771 FvH4_4g24772 FvH4_5g39380
malus_domestica MD10G1199500.v1.1 MD13G1109100.v1.1 MD13G1109200.v1.1 MD13G1114400.v1.1 MD13G1114800.v1.1 MD16G1108800.v1.1
prunus_persica Prupe.1G235900_v2.0.a1 Prupe.1G236600_v2.0.a1 Prupe.1G236700_v2.0.a1 Prupe.1G236800_v2.0.a1 Prupe.4G142000_v2.0.a1
pyrus_communis pycom10g17180 pycom13g09460 pycom13g09930 pycom13g09940
rosa_chinensis RchiOBHm_Chr3g0490281 RchiOBHm_Chr3g0490291 RchiOBHm_Chr3g0490301 RchiOBHm_Chr4g0417441 RchiOBHm_Chr4g0417461 RchiOBHm_Chr4g0431811 RchiOBHm_Chr4g0431821 RchiOBHm_Chr4g0431851
rosa_laevigata RLG00000006882 RLG00000006886 RLG00000006887 RLG00000007905 RLG00000007911 RLG00000007913 RLG00000029538
rosa_multiflora Rmu_sc0001459.1_g000008 Rmu_sc0001459.1_g000011 Rmu_sc0002489.1_g000020 Rmu_sc0002489.1_g000024 Rmu_sc0002489.1_g000027 Rmu_sc0002489.1_g000028 Rmu_sc0002489.1_g000029 Rmu_sc0004142.1_g000001 Rmu_sc0004142.1_g000024 Rmu_sc0011237.1_g000018 Rmu_sc0031439.1_g000001 Rmu_sc0031677.1_g000001 Rmu_ssc0000361.1_g000005
rosa_roxburghii Rroxscaffold_3G00262760 Rroxscaffold_4G00317310 Rroxscaffold_5G00361150 Rroxscaffold_5G00373190 Rroxscaffold_5G00373210 Rroxscaffold_5G00373220 Rroxscaffold_5G00373240
rosa_rugosa Rorug01G0111100 Rorug04G0252400 Rorug04G0252400 Rorug04G0252400 Rorug04G0252600
rosa_samantha Rh1BG102300 Rh3AG292200 Rh3AG292300 Rh4AG309100 Rh4AG309300 Rh4AG309500 Rh6BG200900
rosa_wichuraiana Rw0G002990 Rw0G003000 Rw0G019170 Rw3G025890 Rw3G025900 Rw4G017830 Rw4G026810 Rw4G026870 Rw4G026880 Rw4G026920 Rw6G017190

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 34
AcuI CTGAAG 1 cut(s) 100
AgsI TTSAA 2 cut(s) 202, 290
AleI CACNNNNGTG 1 cut(s) 57
AluBI AGCT 3 cut(s) 64, 100, 114
AluI AGCT 3 cut(s) 64, 100, 114
Alw21I GWGCWC 1 cut(s) 54
Alw26I GTCTC 1 cut(s) 324
AsuHPI GGTGA 1 cut(s) 180
BaeI ACNNNNGTAYC 2 cut(s) 162, 195
Bbv12I GWGCWC 1 cut(s) 54
BccI CCATC 1 cut(s) 233
BciVI GTATCC 1 cut(s) 217
BcoDI GTCTC 1 cut(s) 324
BfaI CTAG 1 cut(s) 209
BfmI CTRYAG 1 cut(s) 127
BfuI GTATCC 1 cut(s) 217
BlpI GCTNAGC 1 cut(s) 48
Bpu1102I GCTNAGC 1 cut(s) 48
BpuEI CTTGAG 1 cut(s) 76
BsaAI YACGTR 1 cut(s) 174
BseMII CTCAG 1 cut(s) 39
BseRI GAGGAG 1 cut(s) 281
BsiHKAI GWGCWC 1 cut(s) 54
BsmAI GTCTC 1 cut(s) 324
BsmBI CGTCTC 1 cut(s) 324
Bsp1286I GDGCHC 1 cut(s) 54
Bsp1720I GCTNAGC 1 cut(s) 48
BspCNI CTCAG 1 cut(s) 40
BspMAI CTGCAG 1 cut(s) 131
BstBAI YACGTR 1 cut(s) 174
BstDEI CTNAG 1 cut(s) 48
BstMAI GTCTC 1 cut(s) 324
BstNSI RCATGY 1 cut(s) 255
BstSFI CTRYAG 1 cut(s) 127
BsuI GTATCC 1 cut(s) 217
BtsIMutI CAGTG 2 cut(s) 97, 191
CseI GACGC 1 cut(s) 306
CviAII CATG 3 cut(s) 220, 252, 277
CviJI RGCY 6 cut(s) 64, 100, 114, 169, 236, 311
CviKI_1 RGCY 6 cut(s) 64, 100, 114, 169, 236, 311
DdeI CTNAG 1 cut(s) 48
Eco32I GATATC 1 cut(s) 298
Eco57I CTGAAG 1 cut(s) 100
EcoRV GATATC 1 cut(s) 298
Esp3I CGTCTC 1 cut(s) 324
FaeI CATG 3 cut(s) 223, 255, 280
FaiI YATR 5 cut(s) 144, 221, 253, 278, 315
FatI CATG 3 cut(s) 219, 251, 276
FblI GTMKAC 1 cut(s) 34
FspBI CTAG 1 cut(s) 209
HgaI GACGC 1 cut(s) 306
Hin1II CATG 3 cut(s) 223, 255, 280
HphI GGTGA 1 cut(s) 180
Hpy166II GTNNAC 1 cut(s) 35
Hpy188III TCNNGA 1 cut(s) 202
Hpy8I GTNNAC 1 cut(s) 35
HpyAV CCTTC 1 cut(s) 208
HpyCH4IV ACGT 1 cut(s) 173
HpyCH4V TGCA 1 cut(s) 129
HpyF3I CTNAG 1 cut(s) 48
HpySE526I ACGT 1 cut(s) 173
Hsp92II CATG 3 cut(s) 223, 255, 280
MaeI CTAG 1 cut(s) 209
MaeII ACGT 1 cut(s) 173
MhlI GDGCHC 1 cut(s) 54
MnlI CCTC 5 cut(s) 147, 226, 241, 259, 262
MseI TTAA 2 cut(s) 66, 282
MslI CAYNNNNRTG 1 cut(s) 57
NlaIII CATG 3 cut(s) 223, 255, 280
NspI RCATGY 1 cut(s) 255
OliI CACNNNNGTG 1 cut(s) 57
PcsI WCGNNNNNNNCGW 1 cut(s) 179
Ppu21I YACGTR 1 cut(s) 174
PstI CTGCAG 1 cut(s) 131
RseI CAYNNNNRTG 1 cut(s) 57
SaqAI TTAA 2 cut(s) 66, 282
SduI GDGCHC 1 cut(s) 54
SetI ASST 8 cut(s) 34, 46, 66, 102, 116, 176, 200, 210
SfcI CTRYAG 1 cut(s) 127
SmiMI CAYNNNNRTG 1 cut(s) 57
SmlI CTYRAG 1 cut(s) 55
SmoI CTYRAG 1 cut(s) 55
SspMI CTAG 1 cut(s) 209
TaiI ACGT 1 cut(s) 176
TaqI TCGA 1 cut(s) 300
Tru1I TTAA 2 cut(s) 66, 282
Tru9I TTAA 2 cut(s) 66, 282
TscAI CASTG 2 cut(s) 97, 198
TspDTI ATGAA 2 cut(s) 84, 208
TspRI CASTG 2 cut(s) 97, 198
XceI RCATGY 1 cut(s) 255
XmiI GTMKAC 1 cut(s) 34
XspI CTAG 1 cut(s) 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.