Rmu_sc0002489.1_g000028

Vinorine synthase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002489.1
OG0000622
Physical Location & Seq
Reverse (-)
85606 .. 85941
336 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002489.1_g000028.1.cds

Sequence Viewer

Length: 336 bp
atgaaaggtctacaacaaggtgctgagcacttgagtgagcttaatgaaagtgttgatagtgttttcagtggagagctgattacatttagcttcagtagtttctgcagatttcctctgtatgataatgattttggttgggggaagcctacgtgggtatcgtcaccaccactgaccatcaagaacctagtggttttcatggataccaaagaggctgatggaacagaggcatatattagtttggaggaggaagtcatggttagtttgaagctgatatcgagttcttggcttatgcgtctccaagtgggtgctgaactgttttgtttattgacaaaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00940 ko00941 ko00945 ko01100 ko01110 map00940 map00941 map00945 map01100 map01110
Pfam Domains
Protein Families
Transferase

Protein Analysis

111

Amino Acids

12.46

Weight (kDa)

4.51

Isoelectric Point (pI)

34.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000622)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g24710 FvH4_4g24720 FvH4_4g24770 FvH4_4g24771 FvH4_4g24772 FvH4_5g39380
malus_domestica MD10G1199500.v1.1 MD13G1109100.v1.1 MD13G1109200.v1.1 MD13G1114400.v1.1 MD13G1114800.v1.1 MD16G1108800.v1.1
prunus_persica Prupe.1G235900_v2.0.a1 Prupe.1G236600_v2.0.a1 Prupe.1G236700_v2.0.a1 Prupe.1G236800_v2.0.a1 Prupe.4G142000_v2.0.a1
pyrus_communis pycom10g17180 pycom13g09460 pycom13g09930 pycom13g09940
rosa_chinensis RchiOBHm_Chr3g0490281 RchiOBHm_Chr3g0490291 RchiOBHm_Chr3g0490301 RchiOBHm_Chr4g0417441 RchiOBHm_Chr4g0417461 RchiOBHm_Chr4g0431811 RchiOBHm_Chr4g0431821 RchiOBHm_Chr4g0431851
rosa_laevigata RLG00000006882 RLG00000006886 RLG00000006887 RLG00000007905 RLG00000007911 RLG00000007913 RLG00000029538
rosa_multiflora Rmu_sc0001459.1_g000008 Rmu_sc0001459.1_g000011 Rmu_sc0002489.1_g000020 Rmu_sc0002489.1_g000024 Rmu_sc0002489.1_g000027 Rmu_sc0002489.1_g000028 Rmu_sc0002489.1_g000029 Rmu_sc0004142.1_g000001 Rmu_sc0004142.1_g000024 Rmu_sc0011237.1_g000018 Rmu_sc0031439.1_g000001 Rmu_sc0031677.1_g000001 Rmu_ssc0000361.1_g000005
rosa_roxburghii Rroxscaffold_3G00262760 Rroxscaffold_4G00317310 Rroxscaffold_5G00361150 Rroxscaffold_5G00373190 Rroxscaffold_5G00373210 Rroxscaffold_5G00373220 Rroxscaffold_5G00373240
rosa_rugosa Rorug01G0111100 Rorug04G0252400 Rorug04G0252400 Rorug04G0252400 Rorug04G0252600
rosa_samantha Rh1BG102300 Rh3AG292200 Rh3AG292300 Rh4AG309100 Rh4AG309300 Rh4AG309500 Rh6BG200900
rosa_wichuraiana Rw0G002990 Rw0G003000 Rw0G019170 Rw3G025890 Rw3G025900 Rw4G017830 Rw4G026810 Rw4G026870 Rw4G026880 Rw4G026920 Rw6G017190

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 10
AcuI CTGAAG 1 cut(s) 76
AgsI TTSAA 1 cut(s) 265
AleI CACNNNNGTG 1 cut(s) 33
AluBI AGCT 4 cut(s) 40, 76, 90, 268
AluI AGCT 4 cut(s) 40, 76, 90, 268
Alw21I GWGCWC 1 cut(s) 30
Alw26I GTCTC 1 cut(s) 299
AsuHPI GGTGA 1 cut(s) 153
BaeI ACNNNNGTAYC 2 cut(s) 138, 171
Bbv12I GWGCWC 1 cut(s) 30
BccI CCATC 2 cut(s) 182, 209
BciVI GTATCC 1 cut(s) 193
BcoDI GTCTC 1 cut(s) 299
BfaI CTAG 1 cut(s) 185
BfmI CTRYAG 1 cut(s) 103
BfuI GTATCC 1 cut(s) 193
BlpI GCTNAGC 1 cut(s) 24
Bpu1102I GCTNAGC 1 cut(s) 24
BpuEI CTTGAG 1 cut(s) 52
BsaAI YACGTR 1 cut(s) 150
BseMII CTCAG 1 cut(s) 15
BseRI GAGGAG 1 cut(s) 257
BsiHKAI GWGCWC 1 cut(s) 30
BsmAI GTCTC 1 cut(s) 299
BsmBI CGTCTC 1 cut(s) 299
Bsp1286I GDGCHC 1 cut(s) 30
Bsp1720I GCTNAGC 1 cut(s) 24
BspCNI CTCAG 1 cut(s) 16
BspMAI CTGCAG 1 cut(s) 107
Bst4CI ACNGT 1 cut(s) 315
BstBAI YACGTR 1 cut(s) 150
BstDEI CTNAG 1 cut(s) 24
BstMAI GTCTC 1 cut(s) 299
BstSFI CTRYAG 1 cut(s) 103
BsuI GTATCC 1 cut(s) 193
BtsIMutI CAGTG 2 cut(s) 73, 167
CseI GACGC 1 cut(s) 281
CviAII CATG 2 cut(s) 196, 253
CviJI RGCY 7 cut(s) 40, 76, 90, 145, 212, 268, 286
CviKI_1 RGCY 7 cut(s) 40, 76, 90, 145, 212, 268, 286
DdeI CTNAG 1 cut(s) 24
Eco32I GATATC 1 cut(s) 273
Eco57I CTGAAG 1 cut(s) 76
EcoRV GATATC 1 cut(s) 273
Esp3I CGTCTC 1 cut(s) 299
FaeI CATG 2 cut(s) 199, 256
FaiI YATR 6 cut(s) 120, 197, 229, 231, 254, 290
FatI CATG 2 cut(s) 195, 252
FblI GTMKAC 1 cut(s) 10
FspBI CTAG 1 cut(s) 185
HgaI GACGC 1 cut(s) 281
Hin1II CATG 2 cut(s) 199, 256
HphI GGTGA 1 cut(s) 153
Hpy166II GTNNAC 1 cut(s) 11
Hpy188III TCNNGA 1 cut(s) 178
Hpy8I GTNNAC 1 cut(s) 11
HpyCH4III ACNGT 1 cut(s) 315
HpyCH4IV ACGT 1 cut(s) 149
HpyCH4V TGCA 1 cut(s) 105
HpyF3I CTNAG 1 cut(s) 24
HpySE526I ACGT 1 cut(s) 149
Hsp92II CATG 2 cut(s) 199, 256
MaeI CTAG 1 cut(s) 185
MaeII ACGT 1 cut(s) 149
MaeIII GTNAC 1 cut(s) 159
MhlI GDGCHC 1 cut(s) 30
MnlI CCTC 5 cut(s) 123, 202, 217, 235, 238
MseI TTAA 1 cut(s) 42
MslI CAYNNNNRTG 1 cut(s) 33
NlaIII CATG 2 cut(s) 199, 256
NmuCI GTSAC 1 cut(s) 159
OliI CACNNNNGTG 1 cut(s) 33
PcsI WCGNNNNNNNCGW 1 cut(s) 155
Ppu21I YACGTR 1 cut(s) 150
PstI CTGCAG 1 cut(s) 107
RseI CAYNNNNRTG 1 cut(s) 33
SaqAI TTAA 1 cut(s) 42
SduI GDGCHC 1 cut(s) 30
SetI ASST 8 cut(s) 10, 22, 42, 78, 92, 152, 186, 270
SfcI CTRYAG 1 cut(s) 103
SmiMI CAYNNNNRTG 1 cut(s) 33
SmlI CTYRAG 1 cut(s) 31
SmoI CTYRAG 1 cut(s) 31
SspMI CTAG 1 cut(s) 185
TaaI ACNGT 1 cut(s) 315
TaiI ACGT 1 cut(s) 152
TaqI TCGA 1 cut(s) 275
Tru1I TTAA 1 cut(s) 42
Tru9I TTAA 1 cut(s) 42
TscAI CASTG 2 cut(s) 73, 174
TseFI GTSAC 1 cut(s) 159
Tsp45I GTSAC 1 cut(s) 159
TspDTI ATGAA 3 cut(s) 17, 60, 184
TspRI CASTG 2 cut(s) 73, 174
XmiI GTMKAC 1 cut(s) 10
XspI CTAG 1 cut(s) 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.