Rmu_co8133848.1_g000001

Auxin response factors (ARFs) are transcriptional factors that bind specifically to the DNA sequence 5'-TGTCTC-3' found in the auxin-responsive promoter elements (AuxREs)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8133848.1
OG0000804
Physical Location & Seq
Reverse (-)
1 .. 618
618 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8133848.1_g000001.1.cds

Sequence Viewer

Length: 513 bp
ctgcgagccgaaaacggcgacctctgcgtcgggattcggagggccaagcgggggtcgccggaggggtcgtcggaatcggggtggaaccacggcggttctgggggagggtcgggtttgccgtattccgggttctcggtgtttctgaaagatgaagagagcaaaatggggagaaataatgggtttgggaattcgagtctgaataatgggaaggtgagagggggcagaggaggaggaagagtgaggcctgaggctgtggtggaggctgccactcttgcggccaatggacagccgtttgaggtggtttattatccgagagccagcacgccggagttttgtgtgaaggcctcggtggtgagggcggcgatgagggtgcagtggtgctcaggcatgaggtttaagatggcctttgagactgaggactcttctaggattagttggttcatgggaaccatagcttctgttgatgttaatgataaaatccgctggcctaattctccttggagagttctacag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Auxin_resp B3

Protein Analysis

171

Amino Acids

18.5

Weight (kDa)

9.71

Isoelectric Point (pI)

45.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 26
AciI CCGC 5 cut(s) 49, 93, 275, 359, 481
AcoI YGGCCR 1 cut(s) 276
AcsI RAATTY 1 cut(s) 187
AfiI CCNNNNNNNGG 2 cut(s) 51, 125
AluBI AGCT 1 cut(s) 455
AluI AGCT 1 cut(s) 455
Alw21I GWGCWC 1 cut(s) 383
Alw26I GTCTC 1 cut(s) 404
AoxI GGCC 6 cut(s) 42, 242, 276, 342, 402, 485
ApeKI GCWGC 1 cut(s) 263
ApoI RAATTY 1 cut(s) 187
AspS9I GGNCC 1 cut(s) 42
AsuC2I CCSGG 1 cut(s) 127
AsuHPI GGTGA 2 cut(s) 223, 364
AxyI CCTNAGG 1 cut(s) 246
Bbv12I GWGCWC 1 cut(s) 383
BbvI GCAGC 1 cut(s) 250
BccI CCATC 1 cut(s) 394
BceAI ACGGC 4 cut(s) 31, 103, 106, 274
BcgI CGANNNNNNTGC 2 cut(s) 352, 386
BcnI CCSGG 1 cut(s) 127
BcoDI GTCTC 1 cut(s) 404
BfaI CTAG 1 cut(s) 426
BfmI CTRYAG 1 cut(s) 509
BisI GCNGC 3 cut(s) 264, 276, 360
BlsI GCNGC 3 cut(s) 265, 277, 361
Bme1390I CCNGG 1 cut(s) 127
BmgT120I GGNCC 1 cut(s) 42
BmiI GGNNCC 2 cut(s) 86, 448
BmrFI CCNGG 1 cut(s) 127
Bpu10I CCTNAGC 1 cut(s) 382
BpuMI CCSGG 1 cut(s) 127
BsaJI CCNNGG 3 cut(s) 88, 345, 497
BsaXI ACNNNNNCTCC 4 cut(s) 53, 83, 222, 252
Bsc4I CCNNNNNNNGG 2 cut(s) 51, 125
Bse21I CCTNAGG 1 cut(s) 246
BseDI CCNNGG 3 cut(s) 88, 345, 497
BseLI CCNNNNNNNGG 2 cut(s) 51, 125
BseMII CTCAG 3 cut(s) 237, 396, 405
BseRI GAGGAG 2 cut(s) 240, 243
BseXI GCAGC 1 cut(s) 250
BsgI GTGCAG 1 cut(s) 392
BshFI GGCC 6 cut(s) 44, 244, 278, 344, 404, 487
BsiHKAI GWGCWC 1 cut(s) 383
BsiSI CCGG 3 cut(s) 59, 126, 326
BslI CCNNNNNNNGG 2 cut(s) 51, 125
BsmAI GTCTC 1 cut(s) 404
BsnI GGCC 6 cut(s) 44, 244, 278, 344, 404, 487
Bsp1286I GDGCHC 1 cut(s) 383
BspACI CCGC 5 cut(s) 49, 93, 275, 359, 481
BspANI GGCC 6 cut(s) 44, 244, 278, 344, 404, 487
BspCNI CTCAG 3 cut(s) 238, 395, 406
BspLI GGNNCC 2 cut(s) 86, 448
BssECI CCNNGG 3 cut(s) 88, 345, 497
BssT1I CCWWGG 1 cut(s) 497
Bst6I CTCTTC 3 cut(s) 147, 229, 427
BstC8I GCNNGC 4 cut(s) 6, 319, 323, 485
BstDEI CTNAG 3 cut(s) 246, 382, 414
BstDSI CCRYGG 1 cut(s) 88
BstMAI GTCTC 1 cut(s) 404
BstMWI GCNNNNNNNGC 3 cut(s) 24, 55, 272
BstSCI CCNGG 1 cut(s) 125
BstSFI CTRYAG 1 cut(s) 509
BstV1I GCAGC 1 cut(s) 250
Bsu36I CCTNAGG 1 cut(s) 246
BsuRI GGCC 6 cut(s) 44, 244, 278, 344, 404, 487
BtgI CCRYGG 1 cut(s) 88
BtgZI GCGATG 1 cut(s) 377
BtsI GCAGTG 1 cut(s) 380
BtsIMutI CAGTG 1 cut(s) 380
Cac8I GCNNGC 4 cut(s) 6, 319, 323, 485
Cfr13I GGNCC 1 cut(s) 42
CseI GACGC 1 cut(s) 16
CviAII CATG 2 cut(s) 388, 442
DdeI CTNAG 3 cut(s) 246, 382, 414
DrdI GACNNNNNNGTC 1 cut(s) 26
DseDI GACNNNNNNGTC 1 cut(s) 26
EaeI YGGCCR 1 cut(s) 276
Eam1104I CTCTTC 3 cut(s) 147, 229, 427
EarI CTCTTC 3 cut(s) 147, 229, 427
Eco130I CCWWGG 1 cut(s) 497
Eco147I AGGCCT 2 cut(s) 244, 344
Eco81I CCTNAGG 1 cut(s) 246
EcoRI GAATTC 1 cut(s) 187
EcoT14I CCWWGG 1 cut(s) 497
ErhI CCWWGG 1 cut(s) 497
FaeI CATG 2 cut(s) 391, 445
FaiI YATR 3 cut(s) 389, 443, 452
FalI AAGNNNNNCTT 2 cut(s) 389, 421
FatI CATG 2 cut(s) 387, 441
FauI CCCGC 1 cut(s) 42
Fnu4HI GCNGC 3 cut(s) 264, 276, 360
Fsp4HI GCNGC 3 cut(s) 264, 276, 360
FspBI CTAG 1 cut(s) 426
GluI GCNGC 3 cut(s) 264, 276, 360
HaeIII GGCC 6 cut(s) 44, 244, 278, 344, 404, 487
HapII CCGG 3 cut(s) 59, 126, 326
HgaI GACGC 1 cut(s) 16
Hin1II CATG 2 cut(s) 391, 445
HinfI GANTC 4 cut(s) 34, 74, 193, 419
HpaII CCGG 3 cut(s) 59, 126, 326
HphI GGTGA 2 cut(s) 223, 364
Hpy188I TCNGA 5 cut(s) 39, 73, 144, 198, 312
Hpy188III TCNNGA 1 cut(s) 31
Hpy99I CGWCG 2 cut(s) 32, 73
HpyAV CCTTC 2 cut(s) 202, 334
HpyCH4V TGCA 1 cut(s) 373
HpyF10VI GCNNNNNNNGC 3 cut(s) 24, 55, 272
HpyF3I CTNAG 3 cut(s) 246, 382, 414
Hsp92II CATG 2 cut(s) 391, 445
LpnPI CCDG 8 cut(s) 72, 84, 139, 258, 331, 339, 369, 469
Lsp1109I GCAGC 1 cut(s) 250
MaeI CTAG 1 cut(s) 426
MboII GAAGA 3 cut(s) 164, 246, 414
MhlI GDGCHC 1 cut(s) 383
MluCI AATT 2 cut(s) 187, 490
MlyI GAGTC 2 cut(s) 202, 413
MmeI TCCRAC 1 cut(s) 51
MseI TTAA 2 cut(s) 396, 468
MspA1I CMGCKG 1 cut(s) 483
MspI CCGG 3 cut(s) 59, 126, 326
MspR9I CCNGG 1 cut(s) 127
MwoI GCNNNNNNNGC 3 cut(s) 24, 55, 272
NciI CCSGG 1 cut(s) 127
NlaIII CATG 2 cut(s) 391, 445
NlaIV GGNNCC 2 cut(s) 86, 448
PceI AGGCCT 2 cut(s) 244, 344
PcsI WCGNNNNNNNCGW 1 cut(s) 116
PfeI GAWTC 2 cut(s) 34, 74
PkrI GCNGC 3 cut(s) 265, 277, 361
PleI GAGTC 2 cut(s) 201, 413
PpsI GAGTC 2 cut(s) 201, 413
PspN4I GGNNCC 2 cut(s) 86, 448
PspPI GGNCC 1 cut(s) 42
PsrI GAACNNNNNNTAC 2 cut(s) 113, 145
SaqAI TTAA 2 cut(s) 396, 468
SatI GCNGC 3 cut(s) 264, 276, 360
Sau96I GGNCC 1 cut(s) 42
SchI GAGTC 2 cut(s) 202, 413
ScrFI CCNGG 1 cut(s) 127
SduI GDGCHC 1 cut(s) 383
SetI ASST 5 cut(s) 24, 213, 300, 395, 457
SfcI CTRYAG 1 cut(s) 509
Sse9I AATT 2 cut(s) 187, 490
SseBI AGGCCT 2 cut(s) 244, 344
SsiI CCGC 5 cut(s) 49, 93, 275, 359, 481
SspMI CTAG 1 cut(s) 426
StuI AGGCCT 2 cut(s) 244, 344
StyD4I CCNGG 1 cut(s) 125
StyI CCWWGG 1 cut(s) 497
TaqI TCGA 1 cut(s) 191
TasI AATT 2 cut(s) 187, 490
TauI GCSGC 2 cut(s) 278, 362
TfiI GAWTC 2 cut(s) 34, 74
Tru1I TTAA 2 cut(s) 396, 468
Tru9I TTAA 2 cut(s) 396, 468
TscAI CASTG 1 cut(s) 380
TseI GCWGC 1 cut(s) 263
TspDTI ATGAA 2 cut(s) 165, 430
TspRI CASTG 1 cut(s) 380
XapI RAATTY 1 cut(s) 187
XcmI CCANNNNNNNNNTGG 1 cut(s) 95
XspI CTAG 1 cut(s) 426
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.