Rmu_co8286615.1_g000001

ribonuclease H protein At1g65750

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8286615.1
OG0000842
Physical Location & Seq
Reverse (-)
81 .. 740
660 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8286615.1_g000001.1.cds

Sequence Viewer

Length: 660 bp
atgcctctcaattttccgatgagctgggactttgggttcagaagaaacttaaatgaccgagagattgaggagtttgcctcgctggtggttaagctagaaaatgtccgattagtggagtccaaaccagatgaaaggaagtggaagcttgagcctaatgggaaattctcttgcaaatctttccatagcttcttaattagtggtggatcaaatccaatttttgctcctgcaaagtttatttggaatgtcaaggtccctactaaggtgaagattttgggatggcttgtggtacgggggaagacgaatacatgtgatgttcttcaaaggagaagaccgggaagttgtttttctccttactggtgcattttatgcaaagctcaaggggaaagtgctgatcatgtcttcatgcattgtgaagtgcctaatttcttatggaaaaaattattttgggaggcaagagtggactggacaactccattagagagaagtgacttgctaagagaaaactccatagcttttggtaaaggtaaaaaggccagaaccctttggggttgtggggtgctagctgtagtttgggtggtctggatggaaagaaatgaaagattatttgaaaactatggaggggtggagaaggaagacctgtgggagagagtcaagttctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

219

Amino Acids

25.68

Weight (kDa)

9.28

Isoelectric Point (pI)

43.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000842)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15420 FvH4_2g00771 FvH4_3g29363
malus_domestica MD02G1293300.v1.1 MD06G1023000.v1.1 MD09G1232900.v1.1
prunus_persica Prupe.1G181500_v2.0.a1 Prupe.1G572100_v2.0.a1 Prupe.2G095500_v2.0.a1 Prupe.3G150400_v2.0.a1 Prupe.3G156200_v2.0.a1 Prupe.4G274400_v2.0.a1 Prupe.5G070700_v2.0.a1 Prupe.7G038000_v2.0.a1 Prupe.7G164000_v2.0.a1 Prupe.8G056500_v2.0.a1
pyrus_communis pycom04g02040 pycom05g04600 pycom07g05610 pycom08g16130 pycom11g16470 pycom12g07830 pycom15g38190 pycom215g00040
rosa_chinensis RchiOBHm_Chr1g0348881 RchiOBHm_Chr5g0032951 RchiOBHm_Chr6g0273271 RchiOBHm_Chr7g0218191 RchiOBHm_Chr7g0223721
rosa_multiflora Rmu_co8286615.1_g000001 Rmu_sc0001354.1_g000002 Rmu_sc0001925.1_g000003 Rmu_sc0001925.1_g000005 Rmu_sc0002221.1_g000004 Rmu_sc0002316.1_g000096 Rmu_sc0003291.1_g000005 Rmu_sc0003413.1_g000005 Rmu_sc0003542.1_g000011 Rmu_sc0004035.1_g000003 Rmu_sc0004035.1_g000004 Rmu_sc0004145.1_g000016 Rmu_sc0004660.1_g000004 Rmu_sc0005999.1_g000006 Rmu_sc0006123.1_g000002 Rmu_sc0006586.1_g000006 Rmu_sc0006889.1_g000029 Rmu_sc0008035.1_g000014 Rmu_sc0011962.1_g000002 Rmu_sc0029950.1_g000001 Rmu_sc0042409.1_g000001 Rmu_ssc0000238.1_g000013
rosa_roxburghii Rroxscaffold_2G00137410 Rroxscaffold_4G00312010 Rroxscaffold_4G00320800 Rroxscaffold_5G00341720 Rroxscaffold_5G00353530 Rroxscaffold_5G00360290 Rroxscaffold_7G00214170 Rroxscaffold_7G00215920
rosa_rugosa Rorug02G0157000
rosa_samantha Rh4BG196500 Rh6CG346400 Rh7BG241100 Rh7DG316300
rosa_wichuraiana Rw1G003610 Rw7G012170 Rw7G030150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 211
AcsI RAATTY 1 cut(s) 161
AfaI GTAC 1 cut(s) 288
AfiI CCNNNNNNNGG 2 cut(s) 112, 259
AflIII ACRYGT 1 cut(s) 305
AgsI TTSAA 2 cut(s) 320, 608
AloI GAACNNNNNNTCC 2 cut(s) 20, 52
AluBI AGCT 7 cut(s) 24, 94, 145, 186, 374, 512, 563
AluI AGCT 7 cut(s) 24, 94, 145, 186, 374, 512, 563
AlwI GGATC 1 cut(s) 211
AoxI GGCC 1 cut(s) 531
ApoI RAATTY 1 cut(s) 161
AspS9I GGNCC 1 cut(s) 250
AsuC2I CCSGG 1 cut(s) 333
AsuHPI GGTGA 1 cut(s) 274
AsuNHI GCTAGC 1 cut(s) 559
AvaII GGWCC 1 cut(s) 250
BbsI GAAGAC 4 cut(s) 302, 334, 391, 639
BccI CCATC 2 cut(s) 270, 577
BclI TGATCA 1 cut(s) 391
BcnI CCSGG 1 cut(s) 333
BfaI CTAG 3 cut(s) 95, 560, 658
BfmI CTRYAG 1 cut(s) 564
Bme1390I CCNGG 1 cut(s) 333
Bme18I GGWCC 1 cut(s) 250
BmgT120I GGNCC 1 cut(s) 250
BmiI GGNNCC 1 cut(s) 252
BmrFI CCNGG 1 cut(s) 333
BmtI GCTAGC 1 cut(s) 563
BpiI GAAGAC 4 cut(s) 302, 334, 391, 639
BplI GAGNNNNNCTC 2 cut(s) 62, 94
BpuEI CTTGAG 2 cut(s) 167, 360
BpuMI CCSGG 1 cut(s) 333
Bsc4I CCNNNNNNNGG 2 cut(s) 112, 259
Bse1I ACTGG 2 cut(s) 359, 467
BseGI GGATG 2 cut(s) 281, 588
BseLI CCNNNNNNNGG 2 cut(s) 112, 259
BseNI ACTGG 2 cut(s) 359, 467
BseRI GAGGAG 1 cut(s) 83
BseYI CCCAGC 1 cut(s) 24
BshFI GGCC 1 cut(s) 533
BsiSI CCGG 1 cut(s) 332
BslFI GGGAC 2 cut(s) 41, 236
BslI CCNNNNNNNGG 2 cut(s) 112, 259
BsmFI GGGAC 2 cut(s) 41, 236
BsnI GGCC 1 cut(s) 533
Bsp143I GATC 2 cut(s) 203, 391
BspANI GGCC 1 cut(s) 533
BspLI GGNNCC 1 cut(s) 252
BspOI GCTAGC 1 cut(s) 563
BspPI GGATC 1 cut(s) 211
BsrI ACTGG 2 cut(s) 359, 467
BssMI GATC 2 cut(s) 203, 391
BstAPI GCANNNNNTGC 1 cut(s) 366
BstC8I GCNNGC 1 cut(s) 561
BstDEI CTNAG 2 cut(s) 258, 494
BstF5I GGATG 2 cut(s) 281, 588
BstKTI GATC 2 cut(s) 206, 394
BstMBI GATC 2 cut(s) 203, 391
BstMWI GCNNNNNNNGC 1 cut(s) 366
BstNSI RCATGY 1 cut(s) 309
BstSCI CCNGG 1 cut(s) 331
BstSFI CTRYAG 1 cut(s) 564
BstV2I GAAGAC 4 cut(s) 302, 334, 391, 639
BsuRI GGCC 1 cut(s) 533
BtsCI GGATG 2 cut(s) 281, 588
Cac8I GCNNGC 1 cut(s) 561
Cfr13I GGNCC 1 cut(s) 250
Csp6I GTAC 1 cut(s) 287
CviAII CATG 3 cut(s) 306, 395, 403
CviQI GTAC 1 cut(s) 287
DdeI CTNAG 2 cut(s) 258, 494
DpnI GATC 2 cut(s) 205, 393
DpnII GATC 2 cut(s) 203, 391
Eco47I GGWCC 1 cut(s) 250
EcoO109I RGGNCCY 1 cut(s) 250
EcoT22I ATGCAT 1 cut(s) 408
FaeI CATG 3 cut(s) 309, 398, 406
FaiI YATR 8 cut(s) 183, 307, 367, 396, 404, 430, 509, 615
FaqI GGGAC 2 cut(s) 41, 236
FatI CATG 3 cut(s) 305, 394, 402
FbaI TGATCA 1 cut(s) 391
FokI GGATG 2 cut(s) 288, 595
FspBI CTAG 3 cut(s) 95, 560, 658
GsaI CCCAGC 1 cut(s) 28
HaeIII GGCC 1 cut(s) 533
HapII CCGG 1 cut(s) 332
Hin1II CATG 3 cut(s) 309, 398, 406
HindIII AAGCTT 1 cut(s) 143
HinfI GANTC 2 cut(s) 116, 648
HpaII CCGG 1 cut(s) 332
HphI GGTGA 1 cut(s) 274
Hpy166II GTNNAC 1 cut(s) 460
Hpy188I TCNGA 3 cut(s) 18, 41, 107
Hpy188III TCNNGA 1 cut(s) 580
Hpy8I GTNNAC 1 cut(s) 460
HpyAV CCTTC 1 cut(s) 622
HpyCH4V TGCA 5 cut(s) 171, 227, 360, 369, 406
HpyF10VI GCNNNNNNNGC 1 cut(s) 366
HpyF3I CTNAG 2 cut(s) 258, 494
Hsp92II CATG 3 cut(s) 309, 398, 406
Ksp22I TGATCA 1 cut(s) 391
Kzo9I GATC 2 cut(s) 203, 391
LmnI GCTCC 1 cut(s) 226
MaeI CTAG 3 cut(s) 95, 560, 658
MaeIII GTNAC 1 cut(s) 485
MalI GATC 2 cut(s) 205, 393
MboI GATC 2 cut(s) 203, 391
MboII GAAGA 7 cut(s) 54, 277, 307, 308, 339, 391, 644
MluCI AATT 6 cut(s) 10, 161, 192, 213, 421, 437
MlyI GAGTC 2 cut(s) 125, 657
MnlI CCTC 5 cut(s) 15, 61, 88, 442, 611
Mph1103I ATGCAT 1 cut(s) 408
MseI TTAA 3 cut(s) 50, 90, 191
MspI CCGG 1 cut(s) 332
MspR9I CCNGG 1 cut(s) 333
MwoI GCNNNNNNNGC 1 cut(s) 366
NciI CCSGG 1 cut(s) 333
NdeII GATC 2 cut(s) 203, 391
NheI GCTAGC 1 cut(s) 559
NlaIII CATG 3 cut(s) 309, 398, 406
NlaIV GGNNCC 1 cut(s) 252
NmuCI GTSAC 1 cut(s) 485
NsiI ATGCAT 1 cut(s) 408
NspI RCATGY 1 cut(s) 309
PciI ACATGT 1 cut(s) 305
PleI GAGTC 2 cut(s) 124, 656
PpsI GAGTC 2 cut(s) 124, 656
PpuMI RGGWCCY 1 cut(s) 250
PscI ACATGT 1 cut(s) 305
Psp5II RGGWCCY 1 cut(s) 250
PspFI CCCAGC 1 cut(s) 24
PspN4I GGNNCC 1 cut(s) 252
PspPI GGNCC 1 cut(s) 250
PspPPI RGGWCCY 1 cut(s) 250
RsaI GTAC 1 cut(s) 288
RsaNI GTAC 1 cut(s) 287
SaqAI TTAA 3 cut(s) 50, 90, 191
Sau3AI GATC 2 cut(s) 203, 391
Sau96I GGNCC 1 cut(s) 250
SchI GAGTC 2 cut(s) 125, 657
ScrFI CCNGG 1 cut(s) 333
SfcI CTRYAG 1 cut(s) 564
SinI GGWCC 1 cut(s) 250
SmlI CTYRAG 2 cut(s) 146, 375
SmoI CTYRAG 2 cut(s) 146, 375
Sse9I AATT 6 cut(s) 10, 161, 192, 213, 421, 437
SspMI CTAG 3 cut(s) 95, 560, 658
StyD4I CCNGG 1 cut(s) 331
TaqII GACCGA 1 cut(s) 72
TasI AATT 6 cut(s) 10, 161, 192, 213, 421, 437
Tru1I TTAA 3 cut(s) 50, 90, 191
Tru9I TTAA 3 cut(s) 50, 90, 191
TseFI GTSAC 1 cut(s) 485
Tsp45I GTSAC 1 cut(s) 485
TspDTI ATGAA 3 cut(s) 144, 391, 609
VpaK11BI GGWCC 1 cut(s) 250
XapI RAATTY 1 cut(s) 161
XceI RCATGY 1 cut(s) 309
XspI CTAG 3 cut(s) 95, 560, 658
Zsp2I ATGCAT 1 cut(s) 408
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.