Rmu_sc0004145.1_g000016

beta-mannosidase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004145.1
OG0000842
Physical Location & Seq
Forward (+)
120378 .. 120824
447 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004145.1_g000016.1.cds

Sequence Viewer

Length: 447 bp
atgggctgcgactttgggttcagaagaaacttaaatgatcaagagattgaggagtttacctcgctgatggttaagctagaaaatgtccgattagtggagtccaaactagatgaaaggaggtggaagcttgagcctaatgggaaattctcttgcaaatttttccatagcttcttaattagtggtggatcagatccaattttcgctcctgcaaagtttatttggaaggtcaaggtccctactaaggtgaagattttgggatggcttgtggtactggggaagacgaatacatgtgatgttcttcaaaggagaagaccaggaagttgtttttctcctcactggtgcattttatgcaaagctcaaggggaaagtgctgatcatgtcttcgtgcattgtgaagtggctaatttcttatggaaaaaattatttagggaggcaagagtggactag

Protein Analysis

148

Amino Acids

17.18

Weight (kDa)

9.17

Isoelectric Point (pI)

53.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000842)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15420 FvH4_2g00771 FvH4_3g29363
malus_domestica MD02G1293300.v1.1 MD06G1023000.v1.1 MD09G1232900.v1.1
prunus_persica Prupe.1G181500_v2.0.a1 Prupe.1G572100_v2.0.a1 Prupe.2G095500_v2.0.a1 Prupe.3G150400_v2.0.a1 Prupe.3G156200_v2.0.a1 Prupe.4G274400_v2.0.a1 Prupe.5G070700_v2.0.a1 Prupe.7G038000_v2.0.a1 Prupe.7G164000_v2.0.a1 Prupe.8G056500_v2.0.a1
pyrus_communis pycom04g02040 pycom05g04600 pycom07g05610 pycom08g16130 pycom11g16470 pycom12g07830 pycom15g38190 pycom215g00040
rosa_chinensis RchiOBHm_Chr1g0348881 RchiOBHm_Chr5g0032951 RchiOBHm_Chr6g0273271 RchiOBHm_Chr7g0218191 RchiOBHm_Chr7g0223721
rosa_multiflora Rmu_co8286615.1_g000001 Rmu_sc0001354.1_g000002 Rmu_sc0001925.1_g000003 Rmu_sc0001925.1_g000005 Rmu_sc0002221.1_g000004 Rmu_sc0002316.1_g000096 Rmu_sc0003291.1_g000005 Rmu_sc0003413.1_g000005 Rmu_sc0003542.1_g000011 Rmu_sc0004035.1_g000003 Rmu_sc0004035.1_g000004 Rmu_sc0004145.1_g000016 Rmu_sc0004660.1_g000004 Rmu_sc0005999.1_g000006 Rmu_sc0006123.1_g000002 Rmu_sc0006586.1_g000006 Rmu_sc0006889.1_g000029 Rmu_sc0008035.1_g000014 Rmu_sc0011962.1_g000002 Rmu_sc0029950.1_g000001 Rmu_sc0042409.1_g000001 Rmu_ssc0000238.1_g000013
rosa_roxburghii Rroxscaffold_2G00137410 Rroxscaffold_4G00312010 Rroxscaffold_4G00320800 Rroxscaffold_5G00341720 Rroxscaffold_5G00353530 Rroxscaffold_5G00360290 Rroxscaffold_7G00214170 Rroxscaffold_7G00215920
rosa_rugosa Rorug02G0157000
rosa_samantha Rh4BG196500 Rh6CG346400 Rh7BG241100 Rh7DG316300
rosa_wichuraiana Rw1G003610 Rw7G012170 Rw7G030150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 185, 193
AcsI RAATTY 2 cut(s) 143, 155
AfaI GTAC 1 cut(s) 270
AfiI CCNNNNNNNGG 2 cut(s) 94, 241
AflIII ACRYGT 1 cut(s) 287
AgsI TTSAA 1 cut(s) 302
AjnI CCWGG 1 cut(s) 313
AluBI AGCT 4 cut(s) 76, 127, 168, 356
AluI AGCT 4 cut(s) 76, 127, 168, 356
AlwI GGATC 2 cut(s) 185, 193
ApeKI GCWGC 1 cut(s) 6
ApoI RAATTY 2 cut(s) 143, 155
AspS9I GGNCC 1 cut(s) 232
AsuHPI GGTGA 1 cut(s) 256
AvaII GGWCC 1 cut(s) 232
BbsI GAAGAC 3 cut(s) 284, 316, 373
BccI CCATC 2 cut(s) 61, 252
BciT130I CCWGG 1 cut(s) 315
BclI TGATCA 2 cut(s) 37, 373
BfaI CTAG 3 cut(s) 77, 107, 445
BisI GCNGC 1 cut(s) 7
BlsI GCNGC 1 cut(s) 8
Bme1390I CCNGG 1 cut(s) 315
Bme18I GGWCC 1 cut(s) 232
BmgT120I GGNCC 1 cut(s) 232
BmiI GGNNCC 1 cut(s) 234
BmrFI CCNGG 1 cut(s) 315
BmrI ACTGGG 1 cut(s) 281
BmuI ACTGGG 1 cut(s) 281
BpiI GAAGAC 3 cut(s) 284, 316, 373
BplI GAGNNNNNCTC 2 cut(s) 44, 76
BpuEI CTTGAG 2 cut(s) 149, 342
Bsc4I CCNNNNNNNGG 2 cut(s) 94, 241
Bse1I ACTGG 2 cut(s) 276, 341
BseBI CCWGG 1 cut(s) 315
BseGI GGATG 1 cut(s) 263
BseLI CCNNNNNNNGG 2 cut(s) 94, 241
BseNI ACTGG 2 cut(s) 276, 341
BseRI GAGGAG 2 cut(s) 65, 321
BslFI GGGAC 1 cut(s) 218
BslI CCNNNNNNNGG 2 cut(s) 94, 241
BsmFI GGGAC 1 cut(s) 218
Bsp143I GATC 4 cut(s) 37, 185, 190, 373
BspLI GGNNCC 1 cut(s) 234
BspPI GGATC 2 cut(s) 185, 193
BsrI ACTGG 2 cut(s) 276, 341
BssMI GATC 4 cut(s) 37, 185, 190, 373
Bst2UI CCWGG 1 cut(s) 315
BstAPI GCANNNNNTGC 1 cut(s) 348
BstDEI CTNAG 1 cut(s) 240
BstF5I GGATG 1 cut(s) 263
BstKTI GATC 4 cut(s) 40, 188, 193, 376
BstMBI GATC 4 cut(s) 37, 185, 190, 373
BstMWI GCNNNNNNNGC 1 cut(s) 348
BstNI CCWGG 1 cut(s) 315
BstNSI RCATGY 1 cut(s) 291
BstSCI CCNGG 1 cut(s) 313
BstV2I GAAGAC 3 cut(s) 284, 316, 373
BstX2I RGATCY 1 cut(s) 190
BstYI RGATCY 1 cut(s) 190
BtsCI GGATG 1 cut(s) 263
BtsIMutI CAGTG 1 cut(s) 334
Cfr13I GGNCC 1 cut(s) 232
Csp6I GTAC 1 cut(s) 269
CviAII CATG 2 cut(s) 288, 377
CviJI RGCY 8 cut(s) 6, 76, 127, 133, 168, 262, 356, 401
CviKI_1 RGCY 8 cut(s) 6, 76, 127, 133, 168, 262, 356, 401
CviQI GTAC 1 cut(s) 269
DdeI CTNAG 1 cut(s) 240
DpnI GATC 4 cut(s) 39, 187, 192, 375
DpnII GATC 4 cut(s) 37, 185, 190, 373
Eco47I GGWCC 1 cut(s) 232
EcoO109I RGGNCCY 1 cut(s) 232
EcoRII CCWGG 1 cut(s) 313
FaeI CATG 2 cut(s) 291, 380
FaiI YATR 5 cut(s) 165, 289, 349, 378, 412
FaqI GGGAC 1 cut(s) 218
FatI CATG 2 cut(s) 287, 376
FbaI TGATCA 2 cut(s) 37, 373
Fnu4HI GCNGC 1 cut(s) 7
FokI GGATG 1 cut(s) 270
Fsp4HI GCNGC 1 cut(s) 7
FspBI CTAG 3 cut(s) 77, 107, 445
GluI GCNGC 1 cut(s) 7
Hin1II CATG 2 cut(s) 291, 380
HindIII AAGCTT 1 cut(s) 125
HinfI GANTC 1 cut(s) 98
HphI GGTGA 1 cut(s) 256
Hpy166II GTNNAC 2 cut(s) 57, 442
Hpy188I TCNGA 3 cut(s) 23, 89, 190
Hpy188III TCNNGA 1 cut(s) 41
Hpy8I GTNNAC 2 cut(s) 57, 442
HpyAV CCTTC 1 cut(s) 217
HpyCH4V TGCA 5 cut(s) 153, 209, 342, 351, 388
HpyF10VI GCNNNNNNNGC 1 cut(s) 348
HpyF3I CTNAG 1 cut(s) 240
Hsp92II CATG 2 cut(s) 291, 380
Ksp22I TGATCA 2 cut(s) 37, 373
Kzo9I GATC 4 cut(s) 37, 185, 190, 373
LmnI GCTCC 1 cut(s) 208
LpnPI CCDG 5 cut(s) 219, 257, 300, 322, 327
MaeI CTAG 3 cut(s) 77, 107, 445
MalI GATC 4 cut(s) 39, 187, 192, 375
MboI GATC 4 cut(s) 37, 185, 190, 373
MboII GAAGA 6 cut(s) 36, 259, 289, 290, 321, 373
MflI RGATCY 1 cut(s) 190
MluCI AATT 6 cut(s) 143, 155, 174, 195, 403, 419
MlyI GAGTC 1 cut(s) 107
MnlI CCTC 5 cut(s) 43, 70, 111, 342, 424
MseI TTAA 3 cut(s) 32, 72, 173
MspR9I CCNGG 1 cut(s) 315
MvaI CCWGG 1 cut(s) 315
MwoI GCNNNNNNNGC 1 cut(s) 348
NdeII GATC 4 cut(s) 37, 185, 190, 373
NlaIII CATG 2 cut(s) 291, 380
NlaIV GGNNCC 1 cut(s) 234
NspI RCATGY 1 cut(s) 291
PciI ACATGT 1 cut(s) 287
PkrI GCNGC 1 cut(s) 8
PleI GAGTC 1 cut(s) 106
PpsI GAGTC 1 cut(s) 106
PpuMI RGGWCCY 1 cut(s) 232
PscI ACATGT 1 cut(s) 287
Psp5II RGGWCCY 1 cut(s) 232
Psp6I CCWGG 1 cut(s) 313
PspGI CCWGG 1 cut(s) 313
PspN4I GGNNCC 1 cut(s) 234
PspPI GGNCC 1 cut(s) 232
PspPPI RGGWCCY 1 cut(s) 232
PsuI RGATCY 1 cut(s) 190
RsaI GTAC 1 cut(s) 270
RsaNI GTAC 1 cut(s) 269
SaqAI TTAA 3 cut(s) 32, 72, 173
SatI GCNGC 1 cut(s) 7
Sau3AI GATC 4 cut(s) 37, 185, 190, 373
Sau96I GGNCC 1 cut(s) 232
SchI GAGTC 1 cut(s) 107
ScrFI CCNGG 1 cut(s) 315
SetI ASST 9 cut(s) 62, 78, 122, 129, 170, 228, 234, 246, 358
SinI GGWCC 1 cut(s) 232
SmlI CTYRAG 2 cut(s) 128, 357
SmoI CTYRAG 2 cut(s) 128, 357
Sse9I AATT 6 cut(s) 143, 155, 174, 195, 403, 419
SspMI CTAG 3 cut(s) 77, 107, 445
StyD4I CCNGG 1 cut(s) 313
TasI AATT 6 cut(s) 143, 155, 174, 195, 403, 419
Tru1I TTAA 3 cut(s) 32, 72, 173
Tru9I TTAA 3 cut(s) 32, 72, 173
TscAI CASTG 1 cut(s) 341
TseI GCWGC 1 cut(s) 6
TspDTI ATGAA 1 cut(s) 126
TspRI CASTG 1 cut(s) 341
VpaK11BI GGWCC 1 cut(s) 232
XapI RAATTY 2 cut(s) 143, 155
XceI RCATGY 1 cut(s) 291
XspI CTAG 3 cut(s) 77, 107, 445
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.