Rw7G012170

ribonuclease H protein At1g65750

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
OG0000842
Physical Location & Seq
Forward (+)
11500609 .. 11501352
744 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G012170.1

Sequence Viewer

Length: 744 bp
ATGAGCTGGGACTTTGGGTTCAGAAGAAACTTAAATGACCAAGAGATTGAGGAGTTTGCCTCGCTGATGGTTAAGCTAGAAAATGTCCGATTAGTGGAGTCCAAACCAGATGAAAGGAGGTGGAAGCTTGAGCCTAATGGGAAATTCTCATGCAAATCTTTCCATAGCTTCTTAACTAGTGGTGGATCAAATCCAATTTTTGCTCCTGCAAAGTTTATTTGGAAAGTCAAGGTCCCTACTAAGGTGAAGATTTTGGGATGGCTTGTGTTACCGGGGAAGACAAATACATGTGATGTTCTTCAAAGGAGAAGTCCGGGAAGTTGTTTTTCCCCTCACTGGTGTATTTTATGCAAAGTTCAAGGAGAAAGTGCTGATCATGTCTTCTTGCATTGTGAAGTGGCTAATTTCTTATGGAAAAAATTATTTAGGGAGGCAAGAGTGGACTGGACAACTCCATTAGAGAGAAGTGACTTGCTAAGAGAAAACCCTATAGCTTTTGGTAAAGGTAGAAAGGCCAGAACACTTTGGGGTTGTGGGGTGCTAGCAGCAGTATGGGTGGTCTGGATGGAAAGAAAAAAAAGATTATTTGAAAACTATGGAGGGGTGGAGAAGGAAGACCTGTGGGAGAGAGTCAAGTTCTGGGCATCCTTATGGGTTTCTATTTCAAAGGAATTCAAGGATTATAATCTTTGTTCCATTATTCTTAACTGGCAAGCAGCTGTAGTAGAAGACCCTGAGCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

247

Amino Acids

28.79

Weight (kDa)

9.08

Isoelectric Point (pI)

44.78

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-RVT PF13966 49 - 138 3.5e-17 zinc-binding in reverse transcriptase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000842)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15420 FvH4_2g00771 FvH4_3g29363
malus_domestica MD02G1293300.v1.1 MD06G1023000.v1.1 MD09G1232900.v1.1
prunus_persica Prupe.1G181500_v2.0.a1 Prupe.1G572100_v2.0.a1 Prupe.2G095500_v2.0.a1 Prupe.3G150400_v2.0.a1 Prupe.3G156200_v2.0.a1 Prupe.4G274400_v2.0.a1 Prupe.5G070700_v2.0.a1 Prupe.7G038000_v2.0.a1 Prupe.7G164000_v2.0.a1 Prupe.8G056500_v2.0.a1
pyrus_communis pycom04g02040 pycom05g04600 pycom07g05610 pycom08g16130 pycom11g16470 pycom12g07830 pycom15g38190 pycom215g00040
rosa_chinensis RchiOBHm_Chr1g0348881 RchiOBHm_Chr5g0032951 RchiOBHm_Chr6g0273271 RchiOBHm_Chr7g0218191 RchiOBHm_Chr7g0223721
rosa_multiflora Rmu_co8286615.1_g000001 Rmu_sc0001354.1_g000002 Rmu_sc0001925.1_g000003 Rmu_sc0001925.1_g000005 Rmu_sc0002221.1_g000004 Rmu_sc0002316.1_g000096 Rmu_sc0003291.1_g000005 Rmu_sc0003413.1_g000005 Rmu_sc0003542.1_g000011 Rmu_sc0004035.1_g000003 Rmu_sc0004035.1_g000004 Rmu_sc0004145.1_g000016 Rmu_sc0004660.1_g000004 Rmu_sc0005999.1_g000006 Rmu_sc0006123.1_g000002 Rmu_sc0006586.1_g000006 Rmu_sc0006889.1_g000029 Rmu_sc0008035.1_g000014 Rmu_sc0011962.1_g000002 Rmu_sc0029950.1_g000001 Rmu_sc0042409.1_g000001 Rmu_ssc0000238.1_g000013
rosa_roxburghii Rroxscaffold_2G00137410 Rroxscaffold_4G00312010 Rroxscaffold_4G00320800 Rroxscaffold_5G00341720 Rroxscaffold_5G00353530 Rroxscaffold_5G00360290 Rroxscaffold_7G00214170 Rroxscaffold_7G00215920
rosa_rugosa Rorug02G0157000
rosa_samantha Rh4BG196500 Rh6CG346400 Rh7BG241100 Rh7DG316300
rosa_wichuraiana Rw1G003610 Rw7G012170 Rw7G030150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 684
AclWI GGATC 1 cut(s) 193
AcsI RAATTY 2 cut(s) 143, 671
AfiI CCNNNNNNNGG 3 cut(s) 94, 241, 336
AflIII ACRYGT 1 cut(s) 287
AgsI TTSAA 5 cut(s) 302, 359, 590, 666, 676
AhlI ACTAGT 1 cut(s) 176
AloI GAACNNNNNNTCC 1 cut(s) 34
AluBI AGCT 6 cut(s) 6, 76, 127, 168, 494, 719
AluI AGCT 6 cut(s) 6, 76, 127, 168, 494, 719
AlwI GGATC 1 cut(s) 193
AoxI GGCC 1 cut(s) 513
ApeKI GCWGC 2 cut(s) 545, 716
ApoI RAATTY 2 cut(s) 143, 671
ArsI GACNNNNNNTTYG 2 cut(s) 295, 327
AspS9I GGNCC 1 cut(s) 232
AsuC2I CCSGG 2 cut(s) 273, 315
AsuHPI GGTGA 1 cut(s) 256
AsuNHI GCTAGC 1 cut(s) 541
AvaII GGWCC 1 cut(s) 232
BbsI GAAGAC 4 cut(s) 284, 373, 621, 735
BbvI GCAGC 2 cut(s) 557, 728
BccI CCATC 3 cut(s) 61, 252, 559
BclI TGATCA 1 cut(s) 373
BcnI CCSGG 2 cut(s) 273, 315
BcuI ACTAGT 1 cut(s) 176
BfaI CTAG 3 cut(s) 77, 177, 542
BfmI CTRYAG 2 cut(s) 489, 720
BisI GCNGC 2 cut(s) 546, 717
BlsI GCNGC 2 cut(s) 547, 718
Bme1390I CCNGG 2 cut(s) 273, 315
Bme18I GGWCC 1 cut(s) 232
BmgT120I GGNCC 1 cut(s) 232
BmiI GGNNCC 1 cut(s) 234
BmrFI CCNGG 2 cut(s) 273, 315
BmsI GCATC 1 cut(s) 653
BmtI GCTAGC 1 cut(s) 545
BpiI GAAGAC 4 cut(s) 284, 373, 621, 735
BplI GAGNNNNNCTC 2 cut(s) 44, 76
Bpu10I CCTNAGC 1 cut(s) 735
BpuEI CTTGAG 1 cut(s) 149
BpuMI CCSGG 2 cut(s) 273, 315
BsaBI GATNNNNATC 1 cut(s) 684
BsaJI CCNNGG 1 cut(s) 272
Bsc4I CCNNNNNNNGG 3 cut(s) 94, 241, 336
Bse1I ACTGG 3 cut(s) 341, 449, 713
Bse8I GATNNNNATC 1 cut(s) 684
BseDI CCNNGG 1 cut(s) 272
BseGI GGATG 3 cut(s) 263, 570, 644
BseJI GATNNNNATC 1 cut(s) 684
BseLI CCNNNNNNNGG 3 cut(s) 94, 241, 336
BseMII CTCAG 1 cut(s) 726
BseNI ACTGG 3 cut(s) 341, 449, 713
BseRI GAGGAG 1 cut(s) 65
BseXI GCAGC 2 cut(s) 557, 728
BseYI CCCAGC 1 cut(s) 6
BshFI GGCC 1 cut(s) 515
BsiSI CCGG 2 cut(s) 272, 314
BslFI GGGAC 2 cut(s) 23, 218
BslI CCNNNNNNNGG 3 cut(s) 94, 241, 336
BsmFI GGGAC 2 cut(s) 23, 218
BsnI GGCC 1 cut(s) 515
Bsp143I GATC 2 cut(s) 185, 373
BspANI GGCC 1 cut(s) 515
BspCNI CTCAG 1 cut(s) 727
BspLI GGNNCC 1 cut(s) 234
BspOI GCTAGC 1 cut(s) 545
BspPI GGATC 1 cut(s) 193
BsrI ACTGG 3 cut(s) 341, 449, 713
BssECI CCNNGG 1 cut(s) 272
BssMI GATC 2 cut(s) 185, 373
BstC8I GCNNGC 2 cut(s) 543, 714
BstDEI CTNAG 3 cut(s) 240, 476, 735
BstF5I GGATG 3 cut(s) 263, 570, 644
BstKTI GATC 2 cut(s) 188, 376
BstMBI GATC 2 cut(s) 185, 373
BstNSI RCATGY 1 cut(s) 291
BstSCI CCNGG 2 cut(s) 271, 313
BstSFI CTRYAG 2 cut(s) 489, 720
BstV1I GCAGC 2 cut(s) 557, 728
BstV2I GAAGAC 4 cut(s) 284, 373, 621, 735
BsuRI GGCC 1 cut(s) 515
BtsCI GGATG 3 cut(s) 263, 570, 644
BtsIMutI CAGTG 1 cut(s) 334
Cac8I GCNNGC 2 cut(s) 543, 714
Cfr13I GGNCC 1 cut(s) 232
CviAII CATG 3 cut(s) 150, 288, 377
DdeI CTNAG 3 cut(s) 240, 476, 735
DpnI GATC 2 cut(s) 187, 375
DpnII GATC 2 cut(s) 185, 373
Eco47I GGWCC 1 cut(s) 232
EcoO109I RGGNCCY 1 cut(s) 232
EcoRI GAATTC 1 cut(s) 671
FaeI CATG 3 cut(s) 153, 291, 380
FaqI GGGAC 2 cut(s) 23, 218
FatI CATG 3 cut(s) 149, 287, 376
FbaI TGATCA 1 cut(s) 373
Fnu4HI GCNGC 2 cut(s) 546, 717
FokI GGATG 3 cut(s) 270, 577, 631
Fsp4HI GCNGC 2 cut(s) 546, 717
FspBI CTAG 3 cut(s) 77, 177, 542
GluI GCNGC 2 cut(s) 546, 717
GsaI CCCAGC 1 cut(s) 10
HaeIII GGCC 1 cut(s) 515
HapII CCGG 2 cut(s) 272, 314
Hin1II CATG 3 cut(s) 153, 291, 380
HindIII AAGCTT 1 cut(s) 125
HinfI GANTC 2 cut(s) 98, 630
HpaII CCGG 2 cut(s) 272, 314
HphI GGTGA 1 cut(s) 256
Hpy166II GTNNAC 1 cut(s) 442
Hpy188I TCNGA 2 cut(s) 23, 89
Hpy188III TCNNGA 1 cut(s) 562
Hpy8I GTNNAC 1 cut(s) 442
HpyAV CCTTC 1 cut(s) 604
HpyCH4V TGCA 4 cut(s) 153, 209, 351, 388
HpyF3I CTNAG 3 cut(s) 240, 476, 735
Hsp92II CATG 3 cut(s) 153, 291, 380
Ksp22I TGATCA 1 cut(s) 373
Kzo9I GATC 2 cut(s) 185, 373
LmnI GCTCC 1 cut(s) 208
Lsp1109I GCAGC 2 cut(s) 557, 728
LweI GCATC 1 cut(s) 653
MaeI CTAG 3 cut(s) 77, 177, 542
MaeIII GTNAC 2 cut(s) 267, 467
MalI GATC 2 cut(s) 187, 375
MboI GATC 2 cut(s) 185, 373
MboII GAAGA 7 cut(s) 36, 259, 289, 290, 373, 626, 740
MluCI AATT 5 cut(s) 143, 195, 403, 419, 671
MlyI GAGTC 2 cut(s) 107, 639
MnlI CCTC 6 cut(s) 43, 70, 111, 342, 424, 593
MseI TTAA 4 cut(s) 32, 72, 173, 705
MslI CAYNNNNRTG 1 cut(s) 649
MspA1I CMGCKG 1 cut(s) 719
MspI CCGG 2 cut(s) 272, 314
MspR9I CCNGG 2 cut(s) 273, 315
NciI CCSGG 2 cut(s) 273, 315
NdeII GATC 2 cut(s) 185, 373
NheI GCTAGC 1 cut(s) 541
NlaIII CATG 3 cut(s) 153, 291, 380
NlaIV GGNNCC 1 cut(s) 234
NmuCI GTSAC 1 cut(s) 467
NspI RCATGY 1 cut(s) 291
PciI ACATGT 1 cut(s) 287
PfoI TCCNGGA 1 cut(s) 313
PkrI GCNGC 2 cut(s) 547, 718
PleI GAGTC 2 cut(s) 106, 638
PpsI GAGTC 2 cut(s) 106, 638
PpuMI RGGWCCY 1 cut(s) 232
PscI ACATGT 1 cut(s) 287
PsiI TTATAA 1 cut(s) 684
Psp5II RGGWCCY 1 cut(s) 232
PspFI CCCAGC 1 cut(s) 6
PspN4I GGNNCC 1 cut(s) 234
PspPI GGNCC 1 cut(s) 232
PspPPI RGGWCCY 1 cut(s) 232
PvuII CAGCTG 1 cut(s) 719
RseI CAYNNNNRTG 1 cut(s) 649
SaqAI TTAA 4 cut(s) 32, 72, 173, 705
SatI GCNGC 2 cut(s) 546, 717
Sau3AI GATC 2 cut(s) 185, 373
Sau96I GGNCC 1 cut(s) 232
SchI GAGTC 2 cut(s) 107, 639
ScrFI CCNGG 2 cut(s) 273, 315
SfaNI GCATC 1 cut(s) 653
SfcI CTRYAG 2 cut(s) 489, 720
SinI GGWCC 1 cut(s) 232
SmiMI CAYNNNNRTG 1 cut(s) 649
SmlI CTYRAG 1 cut(s) 128
SmoI CTYRAG 1 cut(s) 128
SpeI ACTAGT 1 cut(s) 176
Sse9I AATT 5 cut(s) 143, 195, 403, 419, 671
SspMI CTAG 3 cut(s) 77, 177, 542
StyD4I CCNGG 2 cut(s) 271, 313
TasI AATT 5 cut(s) 143, 195, 403, 419, 671
Tru1I TTAA 4 cut(s) 32, 72, 173, 705
Tru9I TTAA 4 cut(s) 32, 72, 173, 705
TscAI CASTG 1 cut(s) 341
TseFI GTSAC 1 cut(s) 467
TseI GCWGC 2 cut(s) 545, 716
Tsp45I GTSAC 1 cut(s) 467
TspDTI ATGAA 1 cut(s) 126
TspRI CASTG 1 cut(s) 341
VpaK11BI GGWCC 1 cut(s) 232
XapI RAATTY 2 cut(s) 143, 671
XceI RCATGY 1 cut(s) 291
XspI CTAG 3 cut(s) 77, 177, 542
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.