Rmu_sc0006889.1_g000029

ribonuclease H protein At1g65750

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006889.1
OG0000842
Physical Location & Seq
Reverse (-)
132295 .. 132897
603 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006889.1_g000029.1.cds

Sequence Viewer

Length: 603 bp
atgcctgatgcaaatttgttctcttgcaaatctttccatagcttcttaattagtggtggatcagatccaatttttcctcctgcaaagtttatttggaaggtcaaggtccctactaaggtgaagattttgggatggcttgtggtactggggaagacaaatacatgtgatgttcttcaaaggagaagaccaggaagttgtttttctcctcactggtgcattttatgtaaagctcaaggggaaagttctgatcatgtcttcgtgcattgtgaagtggctaatttcttgtggaaaaaattattttgggaagcaagagtggactggacaactccattacagagaaatgacttgctaaaggaaaaccccatagcgtttggtaaaggtaaaaaggccagaaccctttggggttgtggggtgctagccgtagtttgggtggtctggatggaaagaaataaaagattatttgaaaactatggaggggtggagaaggaagacctgtgggagagagtcaagttttgggcatccttatgggtttctatttctaaggaattcaaggattataacctttcttccattattcttaactggcaagcagctgtagtataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

200

Amino Acids

23.12

Weight (kDa)

9.38

Isoelectric Point (pI)

38.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000842)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15420 FvH4_2g00771 FvH4_3g29363
malus_domestica MD02G1293300.v1.1 MD06G1023000.v1.1 MD09G1232900.v1.1
prunus_persica Prupe.1G181500_v2.0.a1 Prupe.1G572100_v2.0.a1 Prupe.2G095500_v2.0.a1 Prupe.3G150400_v2.0.a1 Prupe.3G156200_v2.0.a1 Prupe.4G274400_v2.0.a1 Prupe.5G070700_v2.0.a1 Prupe.7G038000_v2.0.a1 Prupe.7G164000_v2.0.a1 Prupe.8G056500_v2.0.a1
pyrus_communis pycom04g02040 pycom05g04600 pycom07g05610 pycom08g16130 pycom11g16470 pycom12g07830 pycom15g38190 pycom215g00040
rosa_chinensis RchiOBHm_Chr1g0348881 RchiOBHm_Chr5g0032951 RchiOBHm_Chr6g0273271 RchiOBHm_Chr7g0218191 RchiOBHm_Chr7g0223721
rosa_multiflora Rmu_co8286615.1_g000001 Rmu_sc0001354.1_g000002 Rmu_sc0001925.1_g000003 Rmu_sc0001925.1_g000005 Rmu_sc0002221.1_g000004 Rmu_sc0002316.1_g000096 Rmu_sc0003291.1_g000005 Rmu_sc0003413.1_g000005 Rmu_sc0003542.1_g000011 Rmu_sc0004035.1_g000003 Rmu_sc0004035.1_g000004 Rmu_sc0004145.1_g000016 Rmu_sc0004660.1_g000004 Rmu_sc0005999.1_g000006 Rmu_sc0006123.1_g000002 Rmu_sc0006586.1_g000006 Rmu_sc0006889.1_g000029 Rmu_sc0008035.1_g000014 Rmu_sc0011962.1_g000002 Rmu_sc0029950.1_g000001 Rmu_sc0042409.1_g000001 Rmu_ssc0000238.1_g000013
rosa_roxburghii Rroxscaffold_2G00137410 Rroxscaffold_4G00312010 Rroxscaffold_4G00320800 Rroxscaffold_5G00341720 Rroxscaffold_5G00353530 Rroxscaffold_5G00360290 Rroxscaffold_7G00214170 Rroxscaffold_7G00215920
rosa_rugosa Rorug02G0157000
rosa_samantha Rh4BG196500 Rh6CG346400 Rh7BG241100 Rh7DG316300
rosa_wichuraiana Rw1G003610 Rw7G012170 Rw7G030150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 558
AclWI GGATC 2 cut(s) 59, 67
AcsI RAATTY 2 cut(s) 13, 545
AfaI GTAC 1 cut(s) 144
AfiI CCNNNNNNNGG 2 cut(s) 115, 426
AflIII ACRYGT 1 cut(s) 161
AgsI TTSAA 3 cut(s) 176, 464, 550
AjnI CCWGG 1 cut(s) 187
AluBI AGCT 3 cut(s) 42, 230, 593
AluI AGCT 3 cut(s) 42, 230, 593
AlwI GGATC 2 cut(s) 59, 67
AoxI GGCC 1 cut(s) 387
ApeKI GCWGC 1 cut(s) 590
ApoI RAATTY 2 cut(s) 13, 545
AspS9I GGNCC 1 cut(s) 106
AsuHPI GGTGA 1 cut(s) 130
AsuNHI GCTAGC 1 cut(s) 415
AvaII GGWCC 1 cut(s) 106
BbsI GAAGAC 4 cut(s) 158, 190, 247, 495
BccI CCATC 2 cut(s) 126, 433
BceAI ACGGC 1 cut(s) 404
BciT130I CCWGG 1 cut(s) 189
BclI TGATCA 1 cut(s) 247
BfaI CTAG 1 cut(s) 416
BfmI CTRYAG 1 cut(s) 594
BisI GCNGC 1 cut(s) 591
BlsI GCNGC 1 cut(s) 592
Bme1390I CCNGG 1 cut(s) 189
Bme18I GGWCC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 106
BmiI GGNNCC 1 cut(s) 108
BmrFI CCNGG 1 cut(s) 189
BmrI ACTGGG 1 cut(s) 155
BmsI GCATC 1 cut(s) 527
BmtI GCTAGC 1 cut(s) 419
BmuI ACTGGG 1 cut(s) 155
BpiI GAAGAC 4 cut(s) 158, 190, 247, 495
BpuEI CTTGAG 1 cut(s) 216
Bsc4I CCNNNNNNNGG 2 cut(s) 115, 426
Bse1I ACTGG 4 cut(s) 150, 215, 323, 587
BseBI CCWGG 1 cut(s) 189
BseGI GGATG 3 cut(s) 137, 444, 518
BseLI CCNNNNNNNGG 2 cut(s) 115, 426
BseNI ACTGG 4 cut(s) 150, 215, 323, 587
BseRI GAGGAG 1 cut(s) 195
BshFI GGCC 1 cut(s) 389
BslFI GGGAC 1 cut(s) 92
BslI CCNNNNNNNGG 2 cut(s) 115, 426
BsmFI GGGAC 1 cut(s) 92
BsnI GGCC 1 cut(s) 389
Bsp143I GATC 3 cut(s) 59, 64, 247
BspANI GGCC 1 cut(s) 389
BspLI GGNNCC 1 cut(s) 108
BspOI GCTAGC 1 cut(s) 419
BspPI GGATC 2 cut(s) 59, 67
BsrI ACTGG 4 cut(s) 150, 215, 323, 587
BssMI GATC 3 cut(s) 59, 64, 247
Bst2UI CCWGG 1 cut(s) 189
BstC8I GCNNGC 2 cut(s) 417, 588
BstDEI CTNAG 2 cut(s) 114, 540
BstF5I GGATG 3 cut(s) 137, 444, 518
BstKTI GATC 3 cut(s) 62, 67, 250
BstMBI GATC 3 cut(s) 59, 64, 247
BstNI CCWGG 1 cut(s) 189
BstNSI RCATGY 1 cut(s) 165
BstSCI CCNGG 1 cut(s) 187
BstSFI CTRYAG 1 cut(s) 594
BstV2I GAAGAC 4 cut(s) 158, 190, 247, 495
BstX2I RGATCY 1 cut(s) 64
BstYI RGATCY 1 cut(s) 64
BsuRI GGCC 1 cut(s) 389
BtsCI GGATG 3 cut(s) 137, 444, 518
BtsIMutI CAGTG 1 cut(s) 208
Cac8I GCNNGC 2 cut(s) 417, 588
Cfr13I GGNCC 1 cut(s) 106
Csp6I GTAC 1 cut(s) 143
CviAII CATG 2 cut(s) 162, 251
CviJI RGCY 7 cut(s) 42, 136, 230, 275, 389, 419, 593
CviKI_1 RGCY 7 cut(s) 42, 136, 230, 275, 389, 419, 593
CviQI GTAC 1 cut(s) 143
DdeI CTNAG 2 cut(s) 114, 540
DpnI GATC 3 cut(s) 61, 66, 249
DpnII GATC 3 cut(s) 59, 64, 247
Eco47I GGWCC 1 cut(s) 106
EcoO109I RGGNCCY 1 cut(s) 106
EcoRI GAATTC 1 cut(s) 545
EcoRII CCWGG 1 cut(s) 187
FaeI CATG 2 cut(s) 165, 254
FaiI YATR 9 cut(s) 39, 163, 223, 252, 365, 471, 526, 558, 601
FaqI GGGAC 1 cut(s) 92
FatI CATG 2 cut(s) 161, 250
FbaI TGATCA 1 cut(s) 247
Fnu4HI GCNGC 1 cut(s) 591
FokI GGATG 3 cut(s) 144, 451, 505
Fsp4HI GCNGC 1 cut(s) 591
FspBI CTAG 1 cut(s) 416
GluI GCNGC 1 cut(s) 591
HaeIII GGCC 1 cut(s) 389
Hin1II CATG 2 cut(s) 165, 254
HinfI GANTC 1 cut(s) 504
HphI GGTGA 1 cut(s) 130
Hpy166II GTNNAC 1 cut(s) 316
Hpy188I TCNGA 2 cut(s) 64, 247
Hpy188III TCNNGA 1 cut(s) 436
Hpy8I GTNNAC 1 cut(s) 316
HpyAV CCTTC 2 cut(s) 91, 478
HpyCH4V TGCA 5 cut(s) 11, 27, 83, 216, 262
HpyF3I CTNAG 2 cut(s) 114, 540
Hsp92II CATG 2 cut(s) 165, 254
Ksp22I TGATCA 1 cut(s) 247
Kzo9I GATC 3 cut(s) 59, 64, 247
LweI GCATC 1 cut(s) 527
MaeI CTAG 1 cut(s) 416
MalI GATC 3 cut(s) 61, 66, 249
MboI GATC 3 cut(s) 59, 64, 247
MboII GAAGA 7 cut(s) 133, 163, 164, 195, 247, 500, 558
MflI RGATCY 1 cut(s) 64
MluCI AATT 6 cut(s) 13, 48, 69, 277, 293, 545
MlyI GAGTC 1 cut(s) 513
MnlI CCTC 3 cut(s) 87, 216, 467
MseI TTAA 2 cut(s) 47, 579
MslI CAYNNNNRTG 1 cut(s) 523
MspA1I CMGCKG 1 cut(s) 593
MspR9I CCNGG 1 cut(s) 189
MvaI CCWGG 1 cut(s) 189
NdeII GATC 3 cut(s) 59, 64, 247
NheI GCTAGC 1 cut(s) 415
NlaIII CATG 2 cut(s) 165, 254
NlaIV GGNNCC 1 cut(s) 108
NspI RCATGY 1 cut(s) 165
PciI ACATGT 1 cut(s) 161
PkrI GCNGC 1 cut(s) 592
PleI GAGTC 1 cut(s) 512
PpsI GAGTC 1 cut(s) 512
PpuMI RGGWCCY 1 cut(s) 106
PscI ACATGT 1 cut(s) 161
PsiI TTATAA 1 cut(s) 558
Psp5II RGGWCCY 1 cut(s) 106
Psp6I CCWGG 1 cut(s) 187
PspGI CCWGG 1 cut(s) 187
PspN4I GGNNCC 1 cut(s) 108
PspPI GGNCC 1 cut(s) 106
PspPPI RGGWCCY 1 cut(s) 106
PsuI RGATCY 1 cut(s) 64
PvuII CAGCTG 1 cut(s) 593
RsaI GTAC 1 cut(s) 144
RsaNI GTAC 1 cut(s) 143
RseI CAYNNNNRTG 1 cut(s) 523
SaqAI TTAA 2 cut(s) 47, 579
SatI GCNGC 1 cut(s) 591
Sau3AI GATC 3 cut(s) 59, 64, 247
Sau96I GGNCC 1 cut(s) 106
SchI GAGTC 1 cut(s) 513
ScrFI CCNGG 1 cut(s) 189
SetI ASST 9 cut(s) 44, 102, 108, 120, 232, 382, 495, 564, 595
SfaNI GCATC 1 cut(s) 527
SfcI CTRYAG 1 cut(s) 594
SinI GGWCC 1 cut(s) 106
SmiMI CAYNNNNRTG 1 cut(s) 523
SmlI CTYRAG 1 cut(s) 231
SmoI CTYRAG 1 cut(s) 231
Sse9I AATT 6 cut(s) 13, 48, 69, 277, 293, 545
SspMI CTAG 1 cut(s) 416
StyD4I CCNGG 1 cut(s) 187
TasI AATT 6 cut(s) 13, 48, 69, 277, 293, 545
Tru1I TTAA 2 cut(s) 47, 579
Tru9I TTAA 2 cut(s) 47, 579
TscAI CASTG 1 cut(s) 215
TseI GCWGC 1 cut(s) 590
TspRI CASTG 1 cut(s) 215
VpaK11BI GGWCC 1 cut(s) 106
XapI RAATTY 2 cut(s) 13, 545
XceI RCATGY 1 cut(s) 165
XspI CTAG 1 cut(s) 416
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.