Rmu_sc0004035.1_g000004

ribonuclease H protein At1g65750

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004035.1
OG0000842
Physical Location & Seq
Reverse (-)
19684 .. 20055
372 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004035.1_g000004.1.cds

Sequence Viewer

Length: 372 bp
atgagctgggactttgggttcagaagaaacttaaatgatcaagagattgaggagtttgcctcgctgatggttaagctacaaaatgtccgattagtggattccaaaccagatgaaaggaggtggaagcttgagcctaatgggaaattctcttgcaaatctttccatagcttcttaattagtggtggatcagatccaatttttgctcctgcaaagtatatttggaaggtcaaggtccctactaaggtgaagattttgggatggcttgtggtactggggaagacgaatacatgtgatgttcttcaaaggagaagaccaggaagttgtttttcacctcactggtgcaagttggagagggtaagaagaaccatctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

123

Amino Acids

14.4

Weight (kDa)

9.97

Isoelectric Point (pI)

68.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000842)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15420 FvH4_2g00771 FvH4_3g29363
malus_domestica MD02G1293300.v1.1 MD06G1023000.v1.1 MD09G1232900.v1.1
prunus_persica Prupe.1G181500_v2.0.a1 Prupe.1G572100_v2.0.a1 Prupe.2G095500_v2.0.a1 Prupe.3G150400_v2.0.a1 Prupe.3G156200_v2.0.a1 Prupe.4G274400_v2.0.a1 Prupe.5G070700_v2.0.a1 Prupe.7G038000_v2.0.a1 Prupe.7G164000_v2.0.a1 Prupe.8G056500_v2.0.a1
pyrus_communis pycom04g02040 pycom05g04600 pycom07g05610 pycom08g16130 pycom11g16470 pycom12g07830 pycom15g38190 pycom215g00040
rosa_chinensis RchiOBHm_Chr1g0348881 RchiOBHm_Chr5g0032951 RchiOBHm_Chr6g0273271 RchiOBHm_Chr7g0218191 RchiOBHm_Chr7g0223721
rosa_multiflora Rmu_co8286615.1_g000001 Rmu_sc0001354.1_g000002 Rmu_sc0001925.1_g000003 Rmu_sc0001925.1_g000005 Rmu_sc0002221.1_g000004 Rmu_sc0002316.1_g000096 Rmu_sc0003291.1_g000005 Rmu_sc0003413.1_g000005 Rmu_sc0003542.1_g000011 Rmu_sc0004035.1_g000003 Rmu_sc0004035.1_g000004 Rmu_sc0004145.1_g000016 Rmu_sc0004660.1_g000004 Rmu_sc0005999.1_g000006 Rmu_sc0006123.1_g000002 Rmu_sc0006586.1_g000006 Rmu_sc0006889.1_g000029 Rmu_sc0008035.1_g000014 Rmu_sc0011962.1_g000002 Rmu_sc0029950.1_g000001 Rmu_sc0042409.1_g000001 Rmu_ssc0000238.1_g000013
rosa_roxburghii Rroxscaffold_2G00137410 Rroxscaffold_4G00312010 Rroxscaffold_4G00320800 Rroxscaffold_5G00341720 Rroxscaffold_5G00353530 Rroxscaffold_5G00360290 Rroxscaffold_7G00214170 Rroxscaffold_7G00215920
rosa_rugosa Rorug02G0157000
rosa_samantha Rh4BG196500 Rh6CG346400 Rh7BG241100 Rh7DG316300
rosa_wichuraiana Rw1G003610 Rw7G012170 Rw7G030150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 185, 193
AcsI RAATTY 1 cut(s) 143
AfaI GTAC 1 cut(s) 270
AfiI CCNNNNNNNGG 2 cut(s) 94, 241
AflIII ACRYGT 1 cut(s) 287
AgsI TTSAA 1 cut(s) 302
AjnI CCWGG 1 cut(s) 313
AloI GAACNNNNNNTCC 1 cut(s) 34
AluBI AGCT 4 cut(s) 6, 76, 127, 168
AluI AGCT 4 cut(s) 6, 76, 127, 168
AlwI GGATC 2 cut(s) 185, 193
ApoI RAATTY 1 cut(s) 143
AspS9I GGNCC 1 cut(s) 232
AsuHPI GGTGA 2 cut(s) 256, 321
AvaII GGWCC 1 cut(s) 232
BbsI GAAGAC 2 cut(s) 284, 316
BccI CCATC 2 cut(s) 61, 252
BciT130I CCWGG 1 cut(s) 315
BclI TGATCA 1 cut(s) 37
BfaI CTAG 1 cut(s) 370
Bme1390I CCNGG 1 cut(s) 315
Bme18I GGWCC 1 cut(s) 232
BmgT120I GGNCC 1 cut(s) 232
BmiI GGNNCC 1 cut(s) 234
BmrFI CCNGG 1 cut(s) 315
BmrI ACTGGG 1 cut(s) 281
BmuI ACTGGG 1 cut(s) 281
BpiI GAAGAC 2 cut(s) 284, 316
BplI GAGNNNNNCTC 2 cut(s) 44, 76
BpuEI CTTGAG 1 cut(s) 149
Bsc4I CCNNNNNNNGG 2 cut(s) 94, 241
Bse1I ACTGG 2 cut(s) 276, 341
BseBI CCWGG 1 cut(s) 315
BseGI GGATG 1 cut(s) 263
BseLI CCNNNNNNNGG 2 cut(s) 94, 241
BseNI ACTGG 2 cut(s) 276, 341
BseRI GAGGAG 1 cut(s) 65
BseYI CCCAGC 1 cut(s) 6
BslFI GGGAC 2 cut(s) 23, 218
BslI CCNNNNNNNGG 2 cut(s) 94, 241
BsmFI GGGAC 2 cut(s) 23, 218
Bsp143I GATC 3 cut(s) 37, 185, 190
BspLI GGNNCC 1 cut(s) 234
BspPI GGATC 2 cut(s) 185, 193
BsrI ACTGG 2 cut(s) 276, 341
BssMI GATC 3 cut(s) 37, 185, 190
Bst2UI CCWGG 1 cut(s) 315
BstDEI CTNAG 1 cut(s) 240
BstF5I GGATG 1 cut(s) 263
BstKTI GATC 3 cut(s) 40, 188, 193
BstMBI GATC 3 cut(s) 37, 185, 190
BstNI CCWGG 1 cut(s) 315
BstNSI RCATGY 1 cut(s) 291
BstSCI CCNGG 1 cut(s) 313
BstV2I GAAGAC 2 cut(s) 284, 316
BstX2I RGATCY 1 cut(s) 190
BstYI RGATCY 1 cut(s) 190
BtsCI GGATG 1 cut(s) 263
BtsIMutI CAGTG 1 cut(s) 334
Cfr13I GGNCC 1 cut(s) 232
Csp6I GTAC 1 cut(s) 269
CviAII CATG 1 cut(s) 288
CviJI RGCY 6 cut(s) 6, 76, 127, 133, 168, 262
CviKI_1 RGCY 6 cut(s) 6, 76, 127, 133, 168, 262
CviQI GTAC 1 cut(s) 269
DdeI CTNAG 1 cut(s) 240
DpnI GATC 3 cut(s) 39, 187, 192
DpnII GATC 3 cut(s) 37, 185, 190
Eco47I GGWCC 1 cut(s) 232
EcoO109I RGGNCCY 1 cut(s) 232
EcoRII CCWGG 1 cut(s) 313
FaeI CATG 1 cut(s) 291
FaiI YATR 3 cut(s) 165, 216, 289
FaqI GGGAC 2 cut(s) 23, 218
FatI CATG 1 cut(s) 287
FbaI TGATCA 1 cut(s) 37
FokI GGATG 1 cut(s) 270
FspBI CTAG 1 cut(s) 370
GsaI CCCAGC 1 cut(s) 10
Hin1II CATG 1 cut(s) 291
HindIII AAGCTT 1 cut(s) 125
HinfI GANTC 1 cut(s) 98
HphI GGTGA 2 cut(s) 256, 321
Hpy188I TCNGA 3 cut(s) 23, 89, 190
Hpy188III TCNNGA 1 cut(s) 41
HpyAV CCTTC 1 cut(s) 217
HpyCH4V TGCA 3 cut(s) 153, 209, 342
HpyF3I CTNAG 1 cut(s) 240
Hsp92II CATG 1 cut(s) 291
Ksp22I TGATCA 1 cut(s) 37
Kzo9I GATC 3 cut(s) 37, 185, 190
LmnI GCTCC 1 cut(s) 208
LpnPI CCDG 6 cut(s) 120, 219, 257, 300, 322, 327
MaeI CTAG 1 cut(s) 370
MalI GATC 3 cut(s) 39, 187, 192
MboI GATC 3 cut(s) 37, 185, 190
MboII GAAGA 6 cut(s) 36, 259, 289, 290, 321, 372
MflI RGATCY 1 cut(s) 190
MluCI AATT 3 cut(s) 143, 174, 195
MmeI TCCRAC 1 cut(s) 327
MnlI CCTC 5 cut(s) 43, 70, 111, 342, 345
MseI TTAA 3 cut(s) 32, 72, 173
MspR9I CCNGG 1 cut(s) 315
MvaI CCWGG 1 cut(s) 315
NdeII GATC 3 cut(s) 37, 185, 190
NlaIII CATG 1 cut(s) 291
NlaIV GGNNCC 1 cut(s) 234
NspI RCATGY 1 cut(s) 291
PciI ACATGT 1 cut(s) 287
PfeI GAWTC 1 cut(s) 98
PpuMI RGGWCCY 1 cut(s) 232
PscI ACATGT 1 cut(s) 287
Psp5II RGGWCCY 1 cut(s) 232
Psp6I CCWGG 1 cut(s) 313
PspFI CCCAGC 1 cut(s) 6
PspGI CCWGG 1 cut(s) 313
PspN4I GGNNCC 1 cut(s) 234
PspPI GGNCC 1 cut(s) 232
PspPPI RGGWCCY 1 cut(s) 232
PsuI RGATCY 1 cut(s) 190
RsaI GTAC 1 cut(s) 270
RsaNI GTAC 1 cut(s) 269
SaqAI TTAA 3 cut(s) 32, 72, 173
Sau3AI GATC 3 cut(s) 37, 185, 190
Sau96I GGNCC 1 cut(s) 232
ScrFI CCNGG 1 cut(s) 315
SetI ASST 9 cut(s) 8, 78, 122, 129, 170, 228, 234, 246, 334
SinI GGWCC 1 cut(s) 232
SmlI CTYRAG 1 cut(s) 128
SmoI CTYRAG 1 cut(s) 128
Sse9I AATT 3 cut(s) 143, 174, 195
SspMI CTAG 1 cut(s) 370
StyD4I CCNGG 1 cut(s) 313
TasI AATT 3 cut(s) 143, 174, 195
TfiI GAWTC 1 cut(s) 98
Tru1I TTAA 3 cut(s) 32, 72, 173
Tru9I TTAA 3 cut(s) 32, 72, 173
TscAI CASTG 1 cut(s) 341
TspDTI ATGAA 1 cut(s) 126
TspRI CASTG 1 cut(s) 341
VpaK11BI GGWCC 1 cut(s) 232
XapI RAATTY 1 cut(s) 143
XceI RCATGY 1 cut(s) 291
XspI CTAG 1 cut(s) 370
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.