Rmu_sc0003291.1_g000005

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003291.1
OG0000842
Physical Location & Seq
Reverse (-)
27453 .. 34195
6743 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003291.1_g000005.1.cds

Sequence Viewer

Length: 942 bp
atgcgactgaaaaatgccgtcgccaataccaatagtgacgccaccaaccggtaccagagtcatttgccgtcgccaaaagtcatttgcgacggcagaaacaccgtcgcaaaaagtggggaggaggatagccttaggggtcggggaaggaggatgggtctcgaggtctgcgacgggttgaactacaggcggaggaggaggggtttacggatcggagaaggaggatgggtctcggggtctgcgacggattggactgcaggcggaggaggagggctttacggatcggagaaggaggatggagctactccaacagctgcaaagaacataagggacatcctcatagattttgcccgagtctctggtcagaagatcaatttagataagtcttctatctatttttctaattcggttgatgttagtcgtaaaatttctatctctaatatcttagaggttagtcacagatctactattggaaaatatttaggcattcacaacataattttctggaaagatccagttaatgctaaagaactattgcttaaggtgacaaagaagttatctggttggaaaagggacacactgtccagggcaggcagactaacgcttataaaatctaatttttctggaatccctgtacatgtgatgtcttgctttaaatgtcattccaaagtcactaaggccttagatagagaagctagggatttcttttgggggaaagataataaatcccctcctgtgtcgtggcaacatgtgtgttcgcctaaggctgctgaaggcctgggaattatacctgcagctttgtttaacaaggctgttttagccaaattaggacagaaggtcttgactaaacccaacaactggtgggttgatattgttagaaggaagtacttaaagagacactctttcttctctttgaaaactcaagctaatcattcgatggcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

313

Amino Acids

34.78

Weight (kDa)

10.22

Isoelectric Point (pI)

42.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000842)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15420 FvH4_2g00771 FvH4_3g29363
malus_domestica MD02G1293300.v1.1 MD06G1023000.v1.1 MD09G1232900.v1.1
prunus_persica Prupe.1G181500_v2.0.a1 Prupe.1G572100_v2.0.a1 Prupe.2G095500_v2.0.a1 Prupe.3G150400_v2.0.a1 Prupe.3G156200_v2.0.a1 Prupe.4G274400_v2.0.a1 Prupe.5G070700_v2.0.a1 Prupe.7G038000_v2.0.a1 Prupe.7G164000_v2.0.a1 Prupe.8G056500_v2.0.a1
pyrus_communis pycom04g02040 pycom05g04600 pycom07g05610 pycom08g16130 pycom11g16470 pycom12g07830 pycom15g38190 pycom215g00040
rosa_chinensis RchiOBHm_Chr1g0348881 RchiOBHm_Chr5g0032951 RchiOBHm_Chr6g0273271 RchiOBHm_Chr7g0218191 RchiOBHm_Chr7g0223721
rosa_multiflora Rmu_co8286615.1_g000001 Rmu_sc0001354.1_g000002 Rmu_sc0001925.1_g000003 Rmu_sc0001925.1_g000005 Rmu_sc0002221.1_g000004 Rmu_sc0002316.1_g000096 Rmu_sc0003291.1_g000005 Rmu_sc0003413.1_g000005 Rmu_sc0003542.1_g000011 Rmu_sc0004035.1_g000003 Rmu_sc0004035.1_g000004 Rmu_sc0004145.1_g000016 Rmu_sc0004660.1_g000004 Rmu_sc0005999.1_g000006 Rmu_sc0006123.1_g000002 Rmu_sc0006586.1_g000006 Rmu_sc0006889.1_g000029 Rmu_sc0008035.1_g000014 Rmu_sc0011962.1_g000002 Rmu_sc0029950.1_g000001 Rmu_sc0042409.1_g000001 Rmu_ssc0000238.1_g000013
rosa_roxburghii Rroxscaffold_2G00137410 Rroxscaffold_4G00312010 Rroxscaffold_4G00320800 Rroxscaffold_5G00341720 Rroxscaffold_5G00353530 Rroxscaffold_5G00360290 Rroxscaffold_7G00214170 Rroxscaffold_7G00215920
rosa_rugosa Rorug02G0157000
rosa_samantha Rh4BG196500 Rh6CG346400 Rh7BG241100 Rh7DG316300
rosa_wichuraiana Rw1G003610 Rw7G012170 Rw7G030150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 605
Acc36I ACCTGC 1 cut(s) 796
Acc65I GGTACC 1 cut(s) 51
AccB1I GGYRCC 1 cut(s) 51
AccB7I CCANNNNNTGG 1 cut(s) 855
AciI CCGC 2 cut(s) 187, 258
AclWI GGATC 3 cut(s) 215, 286, 503
AcsI RAATTY 1 cut(s) 423
AcuI CTGAAG 1 cut(s) 789
AcyI GRCGYC 1 cut(s) 39
AfaI GTAC 3 cut(s) 53, 633, 884
AfiI CCNNNNNNNGG 2 cut(s) 48, 855
AflII CTTAAG 1 cut(s) 536
AflIII ACRYGT 2 cut(s) 634, 745
AgeI ACCGGT 1 cut(s) 48
AgsI TTSAA 2 cut(s) 178, 913
AhdI GACNNNNNGTC 2 cut(s) 577, 833
AjnI CCWGG 2 cut(s) 581, 774
AluBI AGCT 5 cut(s) 299, 311, 692, 794, 923
AluI AGCT 5 cut(s) 299, 311, 692, 794, 923
Alw26I GTCTC 4 cut(s) 161, 232, 358, 886
AlwI GGATC 3 cut(s) 215, 286, 503
Ama87I CYCGRG 3 cut(s) 158, 229, 348
AoxI GGCC 2 cut(s) 675, 772
ApeKI GCWGC 3 cut(s) 311, 764, 791
ApoI RAATTY 1 cut(s) 423
AsiGI ACCGGT 1 cut(s) 48
Asp718I GGTACC 1 cut(s) 51
AsuHPI GGTGA 1 cut(s) 553
AvaI CYCGRG 3 cut(s) 158, 229, 348
AxyI CCTNAGG 2 cut(s) 131, 759
BaeI ACNNNNGTAYC 2 cut(s) 43, 76
BanI GGYRCC 1 cut(s) 51
BbsI GAAGAC 1 cut(s) 375
BbvI GCAGC 3 cut(s) 298, 751, 803
BccI CCATC 4 cut(s) 145, 216, 287, 928
BceAI ACGGC 3 cut(s) 2, 52, 106
BciT130I CCWGG 2 cut(s) 583, 776
BcoDI GTCTC 4 cut(s) 161, 232, 358, 886
BfaI CTAG 1 cut(s) 693
BfmI CTRYAG 3 cut(s) 181, 252, 789
BfrI CTTAAG 1 cut(s) 536
BfuAI ACCTGC 1 cut(s) 796
BglII AGATCT 1 cut(s) 458
BisI GCNGC 3 cut(s) 312, 765, 792
BlsI GCNGC 3 cut(s) 313, 766, 793
BmcAI AGTACT 1 cut(s) 884
Bme1390I CCNGG 2 cut(s) 583, 776
BmeRI GACNNNNNGTC 2 cut(s) 577, 833
BmeT110I CYCGRG 3 cut(s) 158, 229, 348
BmiI GGNNCC 1 cut(s) 53
BmrFI CCNGG 2 cut(s) 583, 776
BpiI GAAGAC 1 cut(s) 375
BpuEI CTTGAG 1 cut(s) 903
BsaHI GRCGYC 1 cut(s) 39
BsaI GGTCTC 2 cut(s) 161, 232
BsaJI CCNNGG 2 cut(s) 582, 775
BsaWI WCCGGW 1 cut(s) 48
BsaXI ACNNNNNCTCC 6 cut(s) 139, 169, 184, 210, 214, 240
Bsc4I CCNNNNNNNGG 2 cut(s) 48, 855
Bse118I RCCGGY 1 cut(s) 48
Bse1I ACTGG 2 cut(s) 512, 860
Bse21I CCTNAGG 2 cut(s) 131, 759
BseBI CCWGG 2 cut(s) 583, 776
BseDI CCNNGG 2 cut(s) 582, 775
BseGI GGATG 4 cut(s) 156, 227, 298, 330
BseLI CCNNNNNNNGG 2 cut(s) 48, 855
BseNI ACTGG 2 cut(s) 512, 860
BseRI GAGGAG 5 cut(s) 134, 205, 208, 276, 279
BseXI GCAGC 3 cut(s) 298, 751, 803
BshFI GGCC 2 cut(s) 677, 774
BshNI GGYRCC 1 cut(s) 51
BshTI ACCGGT 1 cut(s) 48
BsiHKCI CYCGRG 3 cut(s) 158, 229, 348
BsiSI CCGG 1 cut(s) 49
BslFI GGGAC 2 cut(s) 341, 584
BslI CCNNNNNNNGG 2 cut(s) 48, 855
BsmAI GTCTC 4 cut(s) 161, 232, 358, 886
BsmFI GGGAC 2 cut(s) 341, 584
BsmI GAATGC 1 cut(s) 483
BsnI GGCC 2 cut(s) 677, 774
Bso31I GGTCTC 2 cut(s) 161, 232
BsoBI CYCGRG 3 cut(s) 158, 229, 348
Bsp1407I TGTACA 1 cut(s) 631
Bsp143I GATC 5 cut(s) 207, 278, 366, 458, 508
BspACI CCGC 2 cut(s) 187, 258
BspANI GGCC 2 cut(s) 677, 774
BspLI GGNNCC 1 cut(s) 53
BspMAI CTGCAG 2 cut(s) 256, 793
BspMI ACCTGC 1 cut(s) 796
BspPI GGATC 3 cut(s) 215, 286, 503
BspT107I GGYRCC 1 cut(s) 51
BspTI CTTAAG 1 cut(s) 536
BspTNI GGTCTC 2 cut(s) 161, 232
BsrFI RCCGGY 1 cut(s) 48
BsrGI TGTACA 1 cut(s) 631
BsrI ACTGG 2 cut(s) 512, 860
BssAI RCCGGY 1 cut(s) 48
BssECI CCNNGG 2 cut(s) 582, 775
BssMI GATC 5 cut(s) 207, 278, 366, 458, 508
BssNI GRCGYC 1 cut(s) 39
Bst2UI CCWGG 2 cut(s) 583, 776
Bst4CI ACNGT 2 cut(s) 103, 579
BstACI GRCGYC 1 cut(s) 39
BstAFI CTTAAG 1 cut(s) 536
BstAUI TGTACA 1 cut(s) 631
BstC8I GCNNGC 2 cut(s) 256, 589
BstDEI CTNAG 5 cut(s) 131, 442, 672, 679, 759
BstF5I GGATG 4 cut(s) 156, 227, 298, 330
BstKTI GATC 5 cut(s) 210, 281, 369, 461, 511
BstMAI GTCTC 4 cut(s) 161, 232, 358, 886
BstMBI GATC 5 cut(s) 207, 278, 366, 458, 508
BstMWI GCNNNNNNNGC 1 cut(s) 815
BstNI CCWGG 2 cut(s) 583, 776
BstNSI RCATGY 2 cut(s) 638, 749
BstSCI CCNGG 2 cut(s) 581, 774
BstSFI CTRYAG 3 cut(s) 181, 252, 789
BstV1I GCAGC 3 cut(s) 298, 751, 803
BstV2I GAAGAC 1 cut(s) 375
BstX2I RGATCY 2 cut(s) 458, 508
BstYI RGATCY 2 cut(s) 458, 508
Bsu36I CCTNAGG 2 cut(s) 131, 759
BsuRI GGCC 2 cut(s) 677, 774
BtsCI GGATG 4 cut(s) 156, 227, 298, 330
BtsIMutI CAGTG 1 cut(s) 575
BveI ACCTGC 1 cut(s) 796
Cac8I GCNNGC 2 cut(s) 256, 589
Cfr10I RCCGGY 1 cut(s) 48
CseI GACGC 1 cut(s) 47
Csp6I GTAC 3 cut(s) 52, 632, 883
CspAI ACCGGT 1 cut(s) 48
CviAII CATG 3 cut(s) 635, 746, 939
CviQI GTAC 3 cut(s) 52, 632, 883
DdeI CTNAG 5 cut(s) 131, 442, 672, 679, 759
DpnI GATC 5 cut(s) 209, 280, 368, 460, 510
DpnII GATC 5 cut(s) 207, 278, 366, 458, 508
DraI TTTAAA 1 cut(s) 652
DriI GACNNNNNGTC 2 cut(s) 577, 833
Eam1105I GACNNNNNGTC 2 cut(s) 577, 833
EciI GGCGGA 2 cut(s) 202, 273
Eco147I AGGCCT 2 cut(s) 677, 774
Eco31I GGTCTC 2 cut(s) 161, 232
Eco57I CTGAAG 1 cut(s) 789
Eco81I CCTNAGG 2 cut(s) 131, 759
Eco88I CYCGRG 3 cut(s) 158, 229, 348
EcoRII CCWGG 2 cut(s) 581, 774
FaeI CATG 3 cut(s) 638, 749, 942
FaiI YATR 8 cut(s) 323, 338, 494, 605, 636, 747, 785, 940
FaqI GGGAC 2 cut(s) 341, 584
FatI CATG 3 cut(s) 634, 745, 938
Fnu4HI GCNGC 3 cut(s) 312, 765, 792
FokI GGATG 4 cut(s) 163, 234, 305, 317
Fsp4HI GCNGC 3 cut(s) 312, 765, 792
FspBI CTAG 1 cut(s) 693
GluI GCNGC 3 cut(s) 312, 765, 792
HaeIII GGCC 2 cut(s) 677, 774
HapII CCGG 1 cut(s) 49
HgaI GACGC 1 cut(s) 47
Hin1I GRCGYC 1 cut(s) 39
Hin1II CATG 3 cut(s) 638, 749, 942
HinfI GANTC 3 cut(s) 58, 351, 624
HpaII CCGG 1 cut(s) 49
HphI GGTGA 1 cut(s) 553
Hpy166II GTNNAC 1 cut(s) 203
Hpy188I TCNGA 3 cut(s) 212, 283, 363
Hpy188III TCNNGA 4 cut(s) 158, 502, 621, 838
Hpy8I GTNNAC 1 cut(s) 203
Hpy99I CGWCG 6 cut(s) 23, 73, 92, 107, 173, 244
HpyAV CCTTC 6 cut(s) 138, 209, 280, 764, 826, 870
HpyCH4III ACNGT 2 cut(s) 103, 579
HpyCH4V TGCA 3 cut(s) 254, 314, 791
HpyF10VI GCNNNNNNNGC 1 cut(s) 815
HpyF3I CTNAG 5 cut(s) 131, 442, 672, 679, 759
Hsp92I GRCGYC 1 cut(s) 39
Hsp92II CATG 3 cut(s) 638, 749, 942
KpnI GGTACC 1 cut(s) 55
Kzo9I GATC 5 cut(s) 207, 278, 366, 458, 508
LmnI GCTCC 1 cut(s) 296
Lsp1109I GCAGC 3 cut(s) 298, 751, 803
MaeI CTAG 1 cut(s) 693
MaeIII GTNAC 4 cut(s) 35, 452, 541, 667
MalI GATC 5 cut(s) 209, 280, 368, 460, 510
MboI GATC 5 cut(s) 207, 278, 366, 458, 508
MboII GAAGA 3 cut(s) 375, 376, 895
MflI RGATCY 2 cut(s) 458, 508
MluCI AATT 7 cut(s) 370, 400, 423, 495, 613, 780, 821
MlyI GAGTC 2 cut(s) 67, 360
MmeI TCCRAC 2 cut(s) 329, 542
MseI TTAA 5 cut(s) 516, 537, 651, 801, 887
MspA1I CMGCKG 1 cut(s) 311
MspCI CTTAAG 1 cut(s) 536
MspI CCGG 1 cut(s) 49
MspR9I CCNGG 2 cut(s) 583, 776
Mva1269I GAATGC 1 cut(s) 483
MvaI CCWGG 2 cut(s) 583, 776
MwoI GCNNNNNNNGC 1 cut(s) 815
NdeII GATC 5 cut(s) 207, 278, 366, 458, 508
NlaIII CATG 3 cut(s) 638, 749, 942
NlaIV GGNNCC 1 cut(s) 53
NmuCI GTSAC 4 cut(s) 35, 452, 541, 667
NspI RCATGY 2 cut(s) 638, 749
PaeR7I CTCGAG 1 cut(s) 158
PceI AGGCCT 2 cut(s) 677, 774
PciI ACATGT 2 cut(s) 634, 745
PcsI WCGNNNNNNNCGW 2 cut(s) 165, 236
PctI GAATGC 1 cut(s) 483
PfeI GAWTC 1 cut(s) 624
PflMI CCANNNNNTGG 1 cut(s) 855
PinAI ACCGGT 1 cut(s) 48
PkrI GCNGC 3 cut(s) 313, 766, 793
PleI GAGTC 2 cut(s) 66, 359
PpsI GAGTC 2 cut(s) 66, 359
PscI ACATGT 2 cut(s) 634, 745
PsiI TTATAA 1 cut(s) 605
Psp6I CCWGG 2 cut(s) 581, 774
PspGI CCWGG 2 cut(s) 581, 774
PspN4I GGNNCC 1 cut(s) 53
PstI CTGCAG 2 cut(s) 256, 793
PsuI RGATCY 2 cut(s) 458, 508
PvuII CAGCTG 1 cut(s) 311
RsaI GTAC 3 cut(s) 53, 633, 884
RsaNI GTAC 3 cut(s) 52, 632, 883
SaqAI TTAA 5 cut(s) 516, 537, 651, 801, 887
SatI GCNGC 3 cut(s) 312, 765, 792
Sau3AI GATC 5 cut(s) 207, 278, 366, 458, 508
ScaI AGTACT 1 cut(s) 884
SchI GAGTC 2 cut(s) 67, 360
ScrFI CCNGG 2 cut(s) 583, 776
SfcI CTRYAG 3 cut(s) 181, 252, 789
Sfr274I CTCGAG 1 cut(s) 158
SlaI CTCGAG 1 cut(s) 158
SmlI CTYRAG 3 cut(s) 158, 536, 918
SmoI CTYRAG 3 cut(s) 158, 536, 918
Sse9I AATT 7 cut(s) 370, 400, 423, 495, 613, 780, 821
SseBI AGGCCT 2 cut(s) 677, 774
SsiI CCGC 2 cut(s) 187, 258
SspI AATATT 1 cut(s) 476
SspMI CTAG 1 cut(s) 693
StuI AGGCCT 2 cut(s) 677, 774
StyD4I CCNGG 2 cut(s) 581, 774
TaaI ACNGT 2 cut(s) 103, 579
TaqI TCGA 2 cut(s) 159, 932
TasI AATT 7 cut(s) 370, 400, 423, 495, 613, 780, 821
TatI WGTACW 2 cut(s) 631, 882
TfiI GAWTC 1 cut(s) 624
Tru1I TTAA 5 cut(s) 516, 537, 651, 801, 887
Tru9I TTAA 5 cut(s) 516, 537, 651, 801, 887
TscAI CASTG 1 cut(s) 582
TseFI GTSAC 4 cut(s) 35, 452, 541, 667
TseI GCWGC 3 cut(s) 311, 764, 791
Tsp45I GTSAC 4 cut(s) 35, 452, 541, 667
TspGWI ACGGA 3 cut(s) 220, 257, 291
TspRI CASTG 1 cut(s) 582
Van91I CCANNNNNTGG 1 cut(s) 855
Vha464I CTTAAG 1 cut(s) 536
XapI RAATTY 1 cut(s) 423
XceI RCATGY 2 cut(s) 638, 749
XhoI CTCGAG 1 cut(s) 158
XspI CTAG 1 cut(s) 693
ZrmI AGTACT 1 cut(s) 884
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.