Rmu_sc0011962.1_g000002

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011962.1
OG0000842
Physical Location & Seq
Forward (+)
4722 .. 5683
962 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011962.1_g000002.1.cds

Sequence Viewer

Length: 465 bp
atgtcttcttctttcaagttaagagcagcagtcaattctttaacttggaaagggatccttgatgcaagacagctaattaacaaagatcacctgtttggctactgtgatattacctccacagtttggagattggcaaagtttcaagctcctattgattggcagcagggctatcttaaggtctttcaagaaatgtttatcaatggaccttattgcagcagtacttttgcaaaaatcatagttacatgctggcaattctggaaggccaggaatgatactattttcagaggaaaagttagcttcccgaatgaagtggcggtaacttctgctaccacattaagcaacattaagacaggaccatcatctggaggggctgggatcaactcaaaccttaaatccaccattaggtgggatcctccccccctccccaaaatgttgtcaaaatcaactttgatggctccaaactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

154

Amino Acids

17.21

Weight (kDa)

9.86

Isoelectric Point (pI)

34.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000842)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15420 FvH4_2g00771 FvH4_3g29363
malus_domestica MD02G1293300.v1.1 MD06G1023000.v1.1 MD09G1232900.v1.1
prunus_persica Prupe.1G181500_v2.0.a1 Prupe.1G572100_v2.0.a1 Prupe.2G095500_v2.0.a1 Prupe.3G150400_v2.0.a1 Prupe.3G156200_v2.0.a1 Prupe.4G274400_v2.0.a1 Prupe.5G070700_v2.0.a1 Prupe.7G038000_v2.0.a1 Prupe.7G164000_v2.0.a1 Prupe.8G056500_v2.0.a1
pyrus_communis pycom04g02040 pycom05g04600 pycom07g05610 pycom08g16130 pycom11g16470 pycom12g07830 pycom15g38190 pycom215g00040
rosa_chinensis RchiOBHm_Chr1g0348881 RchiOBHm_Chr5g0032951 RchiOBHm_Chr6g0273271 RchiOBHm_Chr7g0218191 RchiOBHm_Chr7g0223721
rosa_multiflora Rmu_co8286615.1_g000001 Rmu_sc0001354.1_g000002 Rmu_sc0001925.1_g000003 Rmu_sc0001925.1_g000005 Rmu_sc0002221.1_g000004 Rmu_sc0002316.1_g000096 Rmu_sc0003291.1_g000005 Rmu_sc0003413.1_g000005 Rmu_sc0003542.1_g000011 Rmu_sc0004035.1_g000003 Rmu_sc0004035.1_g000004 Rmu_sc0004145.1_g000016 Rmu_sc0004660.1_g000004 Rmu_sc0005999.1_g000006 Rmu_sc0006123.1_g000002 Rmu_sc0006586.1_g000006 Rmu_sc0006889.1_g000029 Rmu_sc0008035.1_g000014 Rmu_sc0011962.1_g000002 Rmu_sc0029950.1_g000001 Rmu_sc0042409.1_g000001 Rmu_ssc0000238.1_g000013
rosa_roxburghii Rroxscaffold_2G00137410 Rroxscaffold_4G00312010 Rroxscaffold_4G00320800 Rroxscaffold_5G00341720 Rroxscaffold_5G00353530 Rroxscaffold_5G00360290 Rroxscaffold_7G00214170 Rroxscaffold_7G00215920
rosa_rugosa Rorug02G0157000
rosa_samantha Rh4BG196500 Rh6CG346400 Rh7BG241100 Rh7DG316300
rosa_wichuraiana Rw1G003610 Rw7G012170 Rw7G030150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 3 cut(s) 123, 362, 405
AciI CCGC 1 cut(s) 314
AclWI GGATC 5 cut(s) 49, 62, 383, 404, 417
AfaI GTAC 1 cut(s) 220
AfiI CCNNNNNNNGG 4 cut(s) 123, 362, 402, 405
AflII CTTAAG 1 cut(s) 173
AgsI TTSAA 3 cut(s) 16, 143, 185
AjnI CCWGG 1 cut(s) 263
AluBI AGCT 3 cut(s) 73, 146, 297
AluI AGCT 3 cut(s) 73, 146, 297
AlwI GGATC 5 cut(s) 49, 62, 383, 404, 417
AoxI GGCC 1 cut(s) 261
ApeKI GCWGC 3 cut(s) 26, 160, 213
AspS9I GGNCC 2 cut(s) 203, 353
AsuHPI GGTGA 1 cut(s) 80
AvaII GGWCC 2 cut(s) 203, 353
BamHI GGATCC 2 cut(s) 54, 409
BbvI GCAGC 3 cut(s) 38, 172, 225
BccI CCATC 2 cut(s) 364, 445
BciT130I CCWGG 1 cut(s) 265
BfaI CTAG 1 cut(s) 463
BfrI CTTAAG 1 cut(s) 173
BisI GCNGC 3 cut(s) 27, 161, 214
BlsI GCNGC 3 cut(s) 28, 162, 215
BmcAI AGTACT 1 cut(s) 220
Bme1390I CCNGG 1 cut(s) 265
Bme18I GGWCC 2 cut(s) 203, 353
BmgT120I GGNCC 2 cut(s) 203, 353
BmiI GGNNCC 3 cut(s) 56, 411, 456
BmrFI CCNGG 1 cut(s) 265
BmsI GCATC 1 cut(s) 52
BpmI CTGGAG 1 cut(s) 384
Bsc4I CCNNNNNNNGG 4 cut(s) 123, 362, 402, 405
BseBI CCWGG 1 cut(s) 265
BseLI CCNNNNNNNGG 4 cut(s) 123, 362, 402, 405
BseXI GCAGC 3 cut(s) 38, 172, 225
BseYI CCCAGC 1 cut(s) 371
BshFI GGCC 1 cut(s) 263
BslI CCNNNNNNNGG 4 cut(s) 123, 362, 402, 405
BsnI GGCC 1 cut(s) 263
Bsp143I GATC 4 cut(s) 54, 85, 375, 409
BspACI CCGC 1 cut(s) 314
BspANI GGCC 1 cut(s) 263
BspLI GGNNCC 3 cut(s) 56, 411, 456
BspPI GGATC 5 cut(s) 49, 62, 383, 404, 417
BspTI CTTAAG 1 cut(s) 173
BssMI GATC 4 cut(s) 54, 85, 375, 409
Bst2UI CCWGG 1 cut(s) 265
Bst4CI ACNGT 2 cut(s) 104, 121
BstAFI CTTAAG 1 cut(s) 173
BstC8I GCNNGC 1 cut(s) 248
BstKTI GATC 4 cut(s) 57, 88, 378, 412
BstMBI GATC 4 cut(s) 54, 85, 375, 409
BstNI CCWGG 1 cut(s) 265
BstNSI RCATGY 1 cut(s) 246
BstSCI CCNGG 1 cut(s) 263
BstV1I GCAGC 3 cut(s) 38, 172, 225
BstX2I RGATCY 2 cut(s) 54, 409
BstYI RGATCY 2 cut(s) 54, 409
BsuRI GGCC 1 cut(s) 263
Cac8I GCNNGC 1 cut(s) 248
Cfr13I GGNCC 2 cut(s) 203, 353
Csp6I GTAC 1 cut(s) 219
CviAII CATG 1 cut(s) 243
CviJI RGCY 8 cut(s) 73, 99, 146, 168, 263, 297, 371, 455
CviKI_1 RGCY 8 cut(s) 73, 99, 146, 168, 263, 297, 371, 455
CviQI GTAC 1 cut(s) 219
DpnI GATC 4 cut(s) 56, 87, 377, 411
DpnII GATC 4 cut(s) 54, 85, 375, 409
Eco47I GGWCC 2 cut(s) 203, 353
EcoRII CCWGG 1 cut(s) 263
FaeI CATG 1 cut(s) 246
FaiI YATR 2 cut(s) 236, 244
FalI AAGNNNNNCTT 2 cut(s) 42, 74
FatI CATG 1 cut(s) 242
Fnu4HI GCNGC 3 cut(s) 27, 161, 214
Fsp4HI GCNGC 3 cut(s) 27, 161, 214
FspBI CTAG 1 cut(s) 463
GluI GCNGC 3 cut(s) 27, 161, 214
GsaI CCCAGC 1 cut(s) 375
GsuI CTGGAG 1 cut(s) 384
HaeIII GGCC 1 cut(s) 263
Hin1II CATG 1 cut(s) 246
HphI GGTGA 1 cut(s) 80
Hpy188I TCNGA 1 cut(s) 284
Hpy188III TCNNGA 4 cut(s) 185, 256, 301, 363
HpyAV CCTTC 1 cut(s) 253
HpyCH4III ACNGT 2 cut(s) 104, 121
HpyCH4V TGCA 3 cut(s) 65, 213, 227
Hsp92II CATG 1 cut(s) 246
Kzo9I GATC 4 cut(s) 54, 85, 375, 409
LmnI GCTCC 2 cut(s) 151, 460
LpnPI CCDG 9 cut(s) 104, 149, 232, 241, 250, 277, 336, 348, 357
Lsp1109I GCAGC 3 cut(s) 38, 172, 225
LweI GCATC 1 cut(s) 52
MaeI CTAG 1 cut(s) 463
MaeIII GTNAC 2 cut(s) 238, 316
MalI GATC 4 cut(s) 56, 87, 377, 411
MboI GATC 4 cut(s) 54, 85, 375, 409
MflI RGATCY 2 cut(s) 54, 409
MluCI AATT 3 cut(s) 34, 75, 251
MnlI CCTC 5 cut(s) 124, 278, 359, 423, 431
MseI TTAA 7 cut(s) 20, 41, 78, 174, 335, 345, 390
MspCI CTTAAG 1 cut(s) 173
MspR9I CCNGG 1 cut(s) 265
MvaI CCWGG 1 cut(s) 265
NdeII GATC 4 cut(s) 54, 85, 375, 409
NlaIII CATG 1 cut(s) 246
NlaIV GGNNCC 3 cut(s) 56, 411, 456
NspI RCATGY 1 cut(s) 246
PflMI CCANNNNNTGG 3 cut(s) 123, 362, 405
PkrI GCNGC 3 cut(s) 28, 162, 215
Psp6I CCWGG 1 cut(s) 263
PspFI CCCAGC 1 cut(s) 371
PspGI CCWGG 1 cut(s) 263
PspN4I GGNNCC 3 cut(s) 56, 411, 456
PspPI GGNCC 2 cut(s) 203, 353
PsuI RGATCY 2 cut(s) 54, 409
RsaI GTAC 1 cut(s) 220
RsaNI GTAC 1 cut(s) 219
SaqAI TTAA 7 cut(s) 20, 41, 78, 174, 335, 345, 390
SatI GCNGC 3 cut(s) 27, 161, 214
Sau3AI GATC 4 cut(s) 54, 85, 375, 409
Sau96I GGNCC 2 cut(s) 203, 353
ScaI AGTACT 1 cut(s) 220
ScrFI CCNGG 1 cut(s) 265
SetI ASST 9 cut(s) 75, 93, 116, 148, 180, 208, 299, 390, 407
SfaNI GCATC 1 cut(s) 52
SinI GGWCC 2 cut(s) 203, 353
SmlI CTYRAG 1 cut(s) 173
SmoI CTYRAG 1 cut(s) 173
Sse9I AATT 3 cut(s) 34, 75, 251
SsiI CCGC 1 cut(s) 314
SspMI CTAG 1 cut(s) 463
StyD4I CCNGG 1 cut(s) 263
TaaI ACNGT 2 cut(s) 104, 121
TasI AATT 3 cut(s) 34, 75, 251
TatI WGTACW 1 cut(s) 218
Tru1I TTAA 7 cut(s) 20, 41, 78, 174, 335, 345, 390
Tru9I TTAA 7 cut(s) 20, 41, 78, 174, 335, 345, 390
TseI GCWGC 3 cut(s) 26, 160, 213
TspDTI ATGAA 1 cut(s) 321
Van91I CCANNNNNTGG 3 cut(s) 123, 362, 405
Vha464I CTTAAG 1 cut(s) 173
VpaK11BI GGWCC 2 cut(s) 203, 353
XceI RCATGY 1 cut(s) 246
XspI CTAG 1 cut(s) 463
ZrmI AGTACT 1 cut(s) 220
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.