Rh6CG346400

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0000842
Physical Location & Seq
Forward (+)
53716854 .. 53717276
423 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG346400.1

Sequence Viewer

Length: 423 bp
ATGGCCGGCAAGTTCAGTTTTAGAATCACAATGTTAACCTGCCCTTGGAGGCTTCTTTTAGATCTGTTCATCTTTCTGAAAGGTATCTGCTTACATTTTGCATCATACTTGGAATCTGCCAAAACTGAATGCACTTCTGCCATAATTCAGTCTATTGTTGGTATTAATATTCCTTTAACAGATATGTGGGATCAATTTGTTTGGACCCTTTCCTGTAGTGGTAAGCTCAATGTTAAAGCTGCAACTAATGTGCAATTATTCAATAATTATTCATCTCATTTATCAAAAGTCTGGAAAGAAAAATTACCACCAAAAGTTCAATTGTTTGCTAGGCTCTTTTACCAAAGTAGACTTTCTGCAAGGGAAAAGCTTTCAAGATTCTCTAACTTACCAGATGCCTGTCCTATCAATGTTGAATCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

140

Amino Acids

16.0

Weight (kDa)

9.37

Isoelectric Point (pI)

37.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000842)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15420 FvH4_2g00771 FvH4_3g29363
malus_domestica MD02G1293300.v1.1 MD06G1023000.v1.1 MD09G1232900.v1.1
prunus_persica Prupe.1G181500_v2.0.a1 Prupe.1G572100_v2.0.a1 Prupe.2G095500_v2.0.a1 Prupe.3G150400_v2.0.a1 Prupe.3G156200_v2.0.a1 Prupe.4G274400_v2.0.a1 Prupe.5G070700_v2.0.a1 Prupe.7G038000_v2.0.a1 Prupe.7G164000_v2.0.a1 Prupe.8G056500_v2.0.a1
pyrus_communis pycom04g02040 pycom05g04600 pycom07g05610 pycom08g16130 pycom11g16470 pycom12g07830 pycom15g38190 pycom215g00040
rosa_chinensis RchiOBHm_Chr1g0348881 RchiOBHm_Chr5g0032951 RchiOBHm_Chr6g0273271 RchiOBHm_Chr7g0218191 RchiOBHm_Chr7g0223721
rosa_multiflora Rmu_co8286615.1_g000001 Rmu_sc0001354.1_g000002 Rmu_sc0001925.1_g000003 Rmu_sc0001925.1_g000005 Rmu_sc0002221.1_g000004 Rmu_sc0002316.1_g000096 Rmu_sc0003291.1_g000005 Rmu_sc0003413.1_g000005 Rmu_sc0003542.1_g000011 Rmu_sc0004035.1_g000003 Rmu_sc0004035.1_g000004 Rmu_sc0004145.1_g000016 Rmu_sc0004660.1_g000004 Rmu_sc0005999.1_g000006 Rmu_sc0006123.1_g000002 Rmu_sc0006586.1_g000006 Rmu_sc0006889.1_g000029 Rmu_sc0008035.1_g000014 Rmu_sc0011962.1_g000002 Rmu_sc0029950.1_g000001 Rmu_sc0042409.1_g000001 Rmu_ssc0000238.1_g000013
rosa_roxburghii Rroxscaffold_2G00137410 Rroxscaffold_4G00312010 Rroxscaffold_4G00320800 Rroxscaffold_5G00341720 Rroxscaffold_5G00353530 Rroxscaffold_5G00360290 Rroxscaffold_7G00214170 Rroxscaffold_7G00215920
rosa_rugosa Rorug02G0157000
rosa_samantha Rh4BG196500 Rh6CG346400 Rh7BG241100 Rh7DG316300
rosa_wichuraiana Rw1G003610 Rw7G012170 Rw7G030150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 47
AccI GTMKAC 1 cut(s) 349
AclWI GGATC 1 cut(s) 198
AcoI YGGCCR 1 cut(s) 3
AfiI CCNNNNNNNGG 1 cut(s) 45
AgsI TTSAA 4 cut(s) 262, 320, 375, 416
AluBI AGCT 3 cut(s) 226, 239, 370
AluI AGCT 3 cut(s) 226, 239, 370
AlwI GGATC 1 cut(s) 198
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 1 cut(s) 239
AseI ATTAAT 1 cut(s) 165
AspS9I GGNCC 1 cut(s) 204
AvaII GGWCC 1 cut(s) 204
BbvI GCAGC 1 cut(s) 226
BfaI CTAG 1 cut(s) 330
BfmI CTRYAG 1 cut(s) 214
BfuAI ACCTGC 1 cut(s) 47
BglII AGATCT 1 cut(s) 61
BisI GCNGC 1 cut(s) 240
BlsI GCNGC 1 cut(s) 241
Bme18I GGWCC 1 cut(s) 204
BmgT120I GGNCC 1 cut(s) 204
BmiI GGNNCC 1 cut(s) 206
BmsI GCATC 2 cut(s) 110, 385
BsaJI CCNNGG 1 cut(s) 44
Bsc4I CCNNNNNNNGG 1 cut(s) 45
Bse118I RCCGGY 1 cut(s) 5
BseDI CCNNGG 1 cut(s) 44
BseLI CCNNNNNNNGG 1 cut(s) 45
BseXI GCAGC 1 cut(s) 226
BshFI GGCC 1 cut(s) 5
BsiSI CCGG 1 cut(s) 6
BslI CCNNNNNNNGG 1 cut(s) 45
BsmI GAATGC 1 cut(s) 134
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 2 cut(s) 61, 190
BspANI GGCC 1 cut(s) 5
BspLI GGNNCC 1 cut(s) 206
BspMI ACCTGC 1 cut(s) 47
BspPI GGATC 1 cut(s) 198
BsrFI RCCGGY 1 cut(s) 5
BssAI RCCGGY 1 cut(s) 5
BssECI CCNNGG 1 cut(s) 44
BssMI GATC 2 cut(s) 61, 190
BssT1I CCWWGG 1 cut(s) 44
BstC8I GCNNGC 1 cut(s) 7
BstKTI GATC 2 cut(s) 64, 193
BstMBI GATC 2 cut(s) 61, 190
BstSFI CTRYAG 1 cut(s) 214
BstV1I GCAGC 1 cut(s) 226
BstX2I RGATCY 1 cut(s) 61
BstYI RGATCY 1 cut(s) 61
BsuRI GGCC 1 cut(s) 5
BveI ACCTGC 1 cut(s) 47
Cac8I GCNNGC 1 cut(s) 7
Cfr10I RCCGGY 1 cut(s) 5
Cfr13I GGNCC 1 cut(s) 204
CviJI RGCY 6 cut(s) 5, 52, 226, 239, 334, 370
CviKI_1 RGCY 6 cut(s) 5, 52, 226, 239, 334, 370
DpnI GATC 2 cut(s) 63, 192
DpnII GATC 2 cut(s) 61, 190
EaeI YGGCCR 1 cut(s) 3
Eco130I CCWWGG 1 cut(s) 44
Eco47I GGWCC 1 cut(s) 204
EcoT14I CCWWGG 1 cut(s) 44
ErhI CCWWGG 1 cut(s) 44
FaiI YATR 4 cut(s) 106, 143, 185, 421
FblI GTMKAC 1 cut(s) 349
Fnu4HI GCNGC 1 cut(s) 240
Fsp4HI GCNGC 1 cut(s) 240
FspBI CTAG 1 cut(s) 330
GluI GCNGC 1 cut(s) 240
HaeIII GGCC 1 cut(s) 5
HapII CCGG 1 cut(s) 6
HincII GTYRAC 1 cut(s) 36
HindII GTYRAC 1 cut(s) 36
HindIII AAGCTT 1 cut(s) 368
HinfI GANTC 4 cut(s) 24, 113, 378, 416
HpaI GTTAAC 1 cut(s) 36
HpaII CCGG 1 cut(s) 6
Hpy166II GTNNAC 2 cut(s) 36, 350
Hpy188I TCNGA 1 cut(s) 78
Hpy188III TCNNGA 2 cut(s) 292, 375
Hpy8I GTNNAC 2 cut(s) 36, 350
HpyCH4V TGCA 5 cut(s) 101, 132, 242, 253, 359
KroI GCCGGC 1 cut(s) 5
KroNI GCCGGC 1 cut(s) 7
KspAI GTTAAC 1 cut(s) 36
Kzo9I GATC 2 cut(s) 61, 190
LpnPI CCDG 6 cut(s) 19, 52, 226, 277, 405, 412
Lsp1109I GCAGC 1 cut(s) 226
LweI GCATC 2 cut(s) 110, 385
MaeI CTAG 1 cut(s) 330
MalI GATC 2 cut(s) 63, 192
MboI GATC 2 cut(s) 61, 190
MfeI CAATTG 1 cut(s) 320
MflI RGATCY 1 cut(s) 61
MluCI AATT 6 cut(s) 144, 194, 254, 265, 302, 320
MnlI CCTC 1 cut(s) 42
MroNI GCCGGC 1 cut(s) 5
MseI TTAA 4 cut(s) 35, 165, 176, 234
MspI CCGG 1 cut(s) 6
MunI CAATTG 1 cut(s) 320
Mva1269I GAATGC 1 cut(s) 134
NaeI GCCGGC 1 cut(s) 7
NdeII GATC 2 cut(s) 61, 190
NgoMIV GCCGGC 1 cut(s) 5
NlaIV GGNNCC 1 cut(s) 206
PctI GAATGC 1 cut(s) 134
PdiI GCCGGC 1 cut(s) 7
PfeI GAWTC 4 cut(s) 24, 113, 378, 416
PkrI GCNGC 1 cut(s) 241
PshBI ATTAAT 1 cut(s) 165
PspN4I GGNNCC 1 cut(s) 206
PspPI GGNCC 1 cut(s) 204
PsuI RGATCY 1 cut(s) 61
SaqAI TTAA 4 cut(s) 35, 165, 176, 234
SatI GCNGC 1 cut(s) 240
Sau3AI GATC 2 cut(s) 61, 190
Sau96I GGNCC 1 cut(s) 204
SetI ASST 5 cut(s) 41, 85, 228, 241, 372
SfaNI GCATC 2 cut(s) 110, 385
SfcI CTRYAG 1 cut(s) 214
SinI GGWCC 1 cut(s) 204
Sse9I AATT 6 cut(s) 144, 194, 254, 265, 302, 320
SspI AATATT 1 cut(s) 169
SspMI CTAG 1 cut(s) 330
StyI CCWWGG 1 cut(s) 44
TasI AATT 6 cut(s) 144, 194, 254, 265, 302, 320
TfiI GAWTC 4 cut(s) 24, 113, 378, 416
Tru1I TTAA 4 cut(s) 35, 165, 176, 234
Tru9I TTAA 4 cut(s) 35, 165, 176, 234
TseI GCWGC 1 cut(s) 239
TspDTI ATGAA 2 cut(s) 58, 261
VpaK11BI GGWCC 1 cut(s) 204
VspI ATTAAT 1 cut(s) 165
XmiI GTMKAC 1 cut(s) 349
XspI CTAG 1 cut(s) 330
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.