Rmu_sc0002316.1_g000096

ribonuclease H protein At1g65750

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002316.1
OG0000842
Physical Location & Seq
Forward (+)
418688 .. 419782
1095 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002316.1_g000096.1.cds

Sequence Viewer

Length: 894 bp
atggacagagagtgtaagaaggaccatctagttcattgggagatagtgtcgaaaagcaaagaaagaggagggctgggaattgggaacctactagcaagaaacaagtctttcctagggaaatggctttggagatctcctttggagagaaagcccttatggcatgctgtaataaggagtaaatatggatatgatgtgaatgggtgggacataaagccaattttggttgtaggcagtggcaaaagagtgaggtcctgggaagactcttggttagaggatcaccacttgaaattctactttccaaggttgttcagactatcaagacacaacaaccattcagtggaaaggttagctatccctctcaattttccaatgtgctgggactttgggttcagcagaaatttaaatgaccaagagattgaggagtttgcctcgctgatggttaagcaagaaaatgtccgattagtggagtccaattcagatgaaaagaggtggaagcgtgagcctgctgcgaaattctcttgcaaatctttccatagcttcttaactagtggtggatcagatccaattttttgctcctgcaaagattatttggaacgtcaaggggaaagtcctgatcatgtctttgtgcattgtgaagtggctaatttcttatggaaaaagttatttagggaggcaagagtggactggacaactccattagagagaagtgacttgctaagggaaaaccctatagcttttggtaaagggaaaaaggccagaacccgttggggttgtggggtgctagcattctgggcatccttatgggcttctatttctaaggaattcaaggattataatctttcttccattattcttaactggcaagtagctgttaagcccctaagctttgattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

297

Amino Acids

34.88

Weight (kDa)

9.32

Isoelectric Point (pI)

46.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000842)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15420 FvH4_2g00771 FvH4_3g29363
malus_domestica MD02G1293300.v1.1 MD06G1023000.v1.1 MD09G1232900.v1.1
prunus_persica Prupe.1G181500_v2.0.a1 Prupe.1G572100_v2.0.a1 Prupe.2G095500_v2.0.a1 Prupe.3G150400_v2.0.a1 Prupe.3G156200_v2.0.a1 Prupe.4G274400_v2.0.a1 Prupe.5G070700_v2.0.a1 Prupe.7G038000_v2.0.a1 Prupe.7G164000_v2.0.a1 Prupe.8G056500_v2.0.a1
pyrus_communis pycom04g02040 pycom05g04600 pycom07g05610 pycom08g16130 pycom11g16470 pycom12g07830 pycom15g38190 pycom215g00040
rosa_chinensis RchiOBHm_Chr1g0348881 RchiOBHm_Chr5g0032951 RchiOBHm_Chr6g0273271 RchiOBHm_Chr7g0218191 RchiOBHm_Chr7g0223721
rosa_multiflora Rmu_co8286615.1_g000001 Rmu_sc0001354.1_g000002 Rmu_sc0001925.1_g000003 Rmu_sc0001925.1_g000005 Rmu_sc0002221.1_g000004 Rmu_sc0002316.1_g000096 Rmu_sc0003291.1_g000005 Rmu_sc0003413.1_g000005 Rmu_sc0003542.1_g000011 Rmu_sc0004035.1_g000003 Rmu_sc0004035.1_g000004 Rmu_sc0004145.1_g000016 Rmu_sc0004660.1_g000004 Rmu_sc0005999.1_g000006 Rmu_sc0006123.1_g000002 Rmu_sc0006586.1_g000006 Rmu_sc0006889.1_g000029 Rmu_sc0008035.1_g000014 Rmu_sc0011962.1_g000002 Rmu_sc0029950.1_g000001 Rmu_sc0042409.1_g000001 Rmu_ssc0000238.1_g000013
rosa_roxburghii Rroxscaffold_2G00137410 Rroxscaffold_4G00312010 Rroxscaffold_4G00320800 Rroxscaffold_5G00341720 Rroxscaffold_5G00353530 Rroxscaffold_5G00360290 Rroxscaffold_7G00214170 Rroxscaffold_7G00215920
rosa_rugosa Rorug02G0157000
rosa_samantha Rh4BG196500 Rh6CG346400 Rh7BG241100 Rh7DG316300
rosa_wichuraiana Rw1G003610 Rw7G012170 Rw7G030150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 834
AccB7I CCANNNNNTGG 1 cut(s) 337
AclWI GGATC 3 cut(s) 282, 554, 562
AcsI RAATTY 4 cut(s) 287, 397, 512, 821
AfiI CCNNNNNNNGG 2 cut(s) 337, 463
AgsI TTSAA 2 cut(s) 286, 826
AhlI ACTAGT 1 cut(s) 545
AjnI CCWGG 1 cut(s) 251
AloI GAACNNNNNNTCC 2 cut(s) 371, 403
AluBI AGCT 5 cut(s) 350, 537, 734, 869, 885
AluI AGCT 5 cut(s) 350, 537, 734, 869, 885
AlwI GGATC 3 cut(s) 282, 554, 562
AoxI GGCC 1 cut(s) 753
ApeKI GCWGC 1 cut(s) 506
ApoI RAATTY 4 cut(s) 287, 397, 512, 821
AspA2I CCTAGG 1 cut(s) 112
AspS9I GGNCC 2 cut(s) 22, 249
AsuHPI GGTGA 1 cut(s) 269
AsuNHI GCTAGC 1 cut(s) 781
AvaII GGWCC 2 cut(s) 22, 249
AvrII CCTAGG 1 cut(s) 112
BbsI GAAGAC 1 cut(s) 264
BbvI GCAGC 1 cut(s) 493
BccI CCATC 2 cut(s) 33, 430
BciT130I CCWGG 1 cut(s) 253
BclI TGATCA 1 cut(s) 613
BcuI ACTAGT 1 cut(s) 545
BfaI CTAG 5 cut(s) 29, 92, 113, 546, 782
BfmI CTRYAG 1 cut(s) 729
BglI GCCNNNNNGGC 1 cut(s) 157
BglII AGATCT 1 cut(s) 131
BisI GCNGC 1 cut(s) 507
BlnI CCTAGG 1 cut(s) 112
BlsI GCNGC 1 cut(s) 508
Bme1390I CCNGG 1 cut(s) 253
Bme18I GGWCC 2 cut(s) 22, 249
BmgT120I GGNCC 2 cut(s) 22, 249
BmiI GGNNCC 1 cut(s) 86
BmrFI CCNGG 1 cut(s) 253
BmsI GCATC 1 cut(s) 803
BmtI GCTAGC 1 cut(s) 785
BpiI GAAGAC 1 cut(s) 264
BplI GAGNNNNNCTC 2 cut(s) 413, 445
Bpu10I CCTNAGC 2 cut(s) 716, 881
BsaBI GATNNNNATC 1 cut(s) 834
BsaJI CCNNGG 3 cut(s) 112, 252, 299
BsaXI ACNNNNNCTCC 2 cut(s) 32, 62
Bsc4I CCNNNNNNNGG 2 cut(s) 337, 463
Bse1I ACTGG 2 cut(s) 689, 863
Bse8I GATNNNNATC 1 cut(s) 834
BseBI CCWGG 1 cut(s) 253
BseDI CCNNGG 3 cut(s) 112, 252, 299
BseGI GGATG 1 cut(s) 794
BseJI GATNNNNATC 1 cut(s) 834
BseLI CCNNNNNNNGG 2 cut(s) 337, 463
BseNI ACTGG 2 cut(s) 689, 863
BseRI GAGGAG 2 cut(s) 81, 434
BseXI GCAGC 1 cut(s) 493
BseYI CCCAGC 2 cut(s) 73, 375
BshFI GGCC 1 cut(s) 755
BslFI GGGAC 2 cut(s) 218, 392
BslI CCNNNNNNNGG 2 cut(s) 337, 463
BsmFI GGGAC 2 cut(s) 218, 392
BsmI GAATGC 1 cut(s) 785
BsnI GGCC 1 cut(s) 755
Bsp143I GATC 5 cut(s) 131, 274, 554, 559, 613
BspANI GGCC 1 cut(s) 755
BspLI GGNNCC 1 cut(s) 86
BspOI GCTAGC 1 cut(s) 785
BspPI GGATC 3 cut(s) 282, 554, 562
BsrI ACTGG 2 cut(s) 689, 863
BssECI CCNNGG 3 cut(s) 112, 252, 299
BssMI GATC 5 cut(s) 131, 274, 554, 559, 613
BssT1I CCWWGG 2 cut(s) 112, 299
Bst2UI CCWGG 1 cut(s) 253
BstC8I GCNNGC 3 cut(s) 162, 504, 783
BstDEI CTNAG 3 cut(s) 716, 816, 881
BstF5I GGATG 1 cut(s) 794
BstKTI GATC 5 cut(s) 134, 277, 557, 562, 616
BstMBI GATC 5 cut(s) 131, 274, 554, 559, 613
BstMWI GCNNNNNNNGC 2 cut(s) 157, 791
BstNI CCWGG 1 cut(s) 253
BstNSI RCATGY 1 cut(s) 164
BstSCI CCNGG 1 cut(s) 251
BstSFI CTRYAG 1 cut(s) 729
BstV1I GCAGC 1 cut(s) 493
BstV2I GAAGAC 1 cut(s) 264
BstX2I RGATCY 2 cut(s) 131, 559
BstXI CCANNNNNNTGG 1 cut(s) 375
BstYI RGATCY 2 cut(s) 131, 559
BsuRI GGCC 1 cut(s) 755
BtsCI GGATG 1 cut(s) 794
BtsI GCAGTG 1 cut(s) 238
BtsIMutI CAGTG 2 cut(s) 238, 342
Cac8I GCNNGC 3 cut(s) 162, 504, 783
Cfr13I GGNCC 2 cut(s) 22, 249
CviAII CATG 2 cut(s) 161, 617
DdeI CTNAG 3 cut(s) 716, 816, 881
DpnI GATC 5 cut(s) 133, 276, 556, 561, 615
DpnII GATC 5 cut(s) 131, 274, 554, 559, 613
DraI TTTAAA 1 cut(s) 402
Eco130I CCWWGG 2 cut(s) 112, 299
Eco47I GGWCC 2 cut(s) 22, 249
EcoO109I RGGNCCY 1 cut(s) 249
EcoRI GAATTC 1 cut(s) 821
EcoRII CCWGG 1 cut(s) 251
EcoT14I CCWWGG 2 cut(s) 112, 299
ErhI CCWWGG 2 cut(s) 112, 299
FaeI CATG 2 cut(s) 164, 620
FaqI GGGAC 2 cut(s) 218, 392
FatI CATG 2 cut(s) 160, 616
FbaI TGATCA 1 cut(s) 613
Fnu4HI GCNGC 1 cut(s) 507
FokI GGATG 1 cut(s) 781
Fsp4HI GCNGC 1 cut(s) 507
FspBI CTAG 5 cut(s) 29, 92, 113, 546, 782
GluI GCNGC 1 cut(s) 507
GsaI CCCAGC 2 cut(s) 77, 379
HaeIII GGCC 1 cut(s) 755
Hin1II CATG 2 cut(s) 164, 620
HindIII AAGCTT 1 cut(s) 883
HinfI GANTC 2 cut(s) 260, 467
HphI GGTGA 1 cut(s) 269
Hpy166II GTNNAC 1 cut(s) 682
Hpy188I TCNGA 4 cut(s) 311, 458, 478, 559
Hpy188III TCNNGA 2 cut(s) 318, 611
Hpy8I GTNNAC 1 cut(s) 682
HpyAV CCTTC 1 cut(s) 13
HpyCH4IV ACGT 1 cut(s) 595
HpyCH4V TGCA 3 cut(s) 522, 579, 628
HpyF10VI GCNNNNNNNGC 2 cut(s) 157, 791
HpyF3I CTNAG 3 cut(s) 716, 816, 881
HpySE526I ACGT 1 cut(s) 595
Hsp92II CATG 2 cut(s) 164, 620
Ksp22I TGATCA 1 cut(s) 613
Kzo9I GATC 5 cut(s) 131, 274, 554, 559, 613
LmnI GCTCC 1 cut(s) 578
Lsp1109I GCAGC 1 cut(s) 493
LweI GCATC 1 cut(s) 803
MaeI CTAG 5 cut(s) 29, 92, 113, 546, 782
MaeII ACGT 1 cut(s) 595
MaeIII GTNAC 1 cut(s) 707
MalI GATC 5 cut(s) 133, 276, 556, 561, 615
MboI GATC 5 cut(s) 131, 274, 554, 559, 613
MboII GAAGA 2 cut(s) 269, 834
MflI RGATCY 2 cut(s) 131, 559
MlyI GAGTC 2 cut(s) 254, 476
MnlI CCTC 9 cut(s) 59, 62, 240, 265, 366, 412, 439, 480, 664
MseI TTAA 5 cut(s) 401, 441, 542, 855, 873
MslI CAYNNNNRTG 1 cut(s) 799
MspR9I CCNGG 1 cut(s) 253
Mva1269I GAATGC 1 cut(s) 785
MvaI CCWGG 1 cut(s) 253
MwoI GCNNNNNNNGC 2 cut(s) 157, 791
NdeII GATC 5 cut(s) 131, 274, 554, 559, 613
NheI GCTAGC 1 cut(s) 781
NlaIII CATG 2 cut(s) 164, 620
NlaIV GGNNCC 1 cut(s) 86
NmuCI GTSAC 1 cut(s) 707
NspI RCATGY 1 cut(s) 164
PaeI GCATGC 1 cut(s) 164
PctI GAATGC 1 cut(s) 785
PflMI CCANNNNNTGG 1 cut(s) 337
PkrI GCNGC 1 cut(s) 508
PleI GAGTC 2 cut(s) 254, 475
PpsI GAGTC 2 cut(s) 254, 475
PpuMI RGGWCCY 1 cut(s) 249
PsiI TTATAA 1 cut(s) 834
Psp5II RGGWCCY 1 cut(s) 249
Psp6I CCWGG 1 cut(s) 251
PspFI CCCAGC 2 cut(s) 73, 375
PspGI CCWGG 1 cut(s) 251
PspN4I GGNNCC 1 cut(s) 86
PspPI GGNCC 2 cut(s) 22, 249
PspPPI RGGWCCY 1 cut(s) 249
PsuI RGATCY 2 cut(s) 131, 559
RseI CAYNNNNRTG 1 cut(s) 799
SaqAI TTAA 5 cut(s) 401, 441, 542, 855, 873
SatI GCNGC 1 cut(s) 507
Sau3AI GATC 5 cut(s) 131, 274, 554, 559, 613
Sau96I GGNCC 2 cut(s) 22, 249
SchI GAGTC 2 cut(s) 254, 476
ScrFI CCNGG 1 cut(s) 253
SfaNI GCATC 1 cut(s) 803
SfcI CTRYAG 1 cut(s) 729
SinI GGWCC 2 cut(s) 22, 249
SmiI ATTTAAAT 1 cut(s) 402
SmiMI CAYNNNNRTG 1 cut(s) 799
SpeI ACTAGT 1 cut(s) 545
SphI GCATGC 1 cut(s) 164
SspMI CTAG 5 cut(s) 29, 92, 113, 546, 782
StyD4I CCNGG 1 cut(s) 251
StyI CCWWGG 2 cut(s) 112, 299
SwaI ATTTAAAT 1 cut(s) 402
TaiI ACGT 1 cut(s) 598
TaqI TCGA 1 cut(s) 50
Tru1I TTAA 5 cut(s) 401, 441, 542, 855, 873
Tru9I TTAA 5 cut(s) 401, 441, 542, 855, 873
TscAI CASTG 2 cut(s) 238, 342
TseFI GTSAC 1 cut(s) 707
TseI GCWGC 1 cut(s) 506
Tsp45I GTSAC 1 cut(s) 707
TspDTI ATGAA 2 cut(s) 23, 495
TspRI CASTG 2 cut(s) 238, 342
Van91I CCANNNNNTGG 1 cut(s) 337
VpaK11BI GGWCC 2 cut(s) 22, 249
XapI RAATTY 4 cut(s) 287, 397, 512, 821
XceI RCATGY 1 cut(s) 164
XmaJI CCTAGG 1 cut(s) 112
XspI CTAG 5 cut(s) 29, 92, 113, 546, 782
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.