Rmu_sc0002221.1_g000004

ribonuclease H protein At1g65750

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002221.1
OG0000842
Physical Location & Seq
Forward (+)
30617 .. 31345
729 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002221.1_g000004.1.cds

Sequence Viewer

Length: 729 bp
atgagctgggactttgggttcaggagaaacttaaatgaccaagagattgaagaggttgcctcgttgatgactaaactagaaaatgtcagattagtggagtccaaaccagatgaaaggaggtggaagcttgagcctactgggaaattctcttgcaaatctttccatagctttttaactagtggtgcttcagatccaatctctgttcctgcaaagtttatttggaacgtcaaggtccctacaaaggtgaagattttggggtggcttgtggtattggggaagatgaatacttgtgatgtccttcaaaagaaaagaccgggaagttgttcttctcctcactggtgcatcttatgcaagaaccatggagaaagtgctgatcacgtctttgtgcattgtgaagtgactatttccttatggaaaaagctttttagggaggcaagagtggactggacagctcctttacagcgaagcgaattgctaagagaaaaacctttagcttttggtaaagggaaaaaggcaaaaaccctttggggatgtggggtgctagctgtttgttgggtggtctggttggaaagaaatagaagaatttttgaaaactatggaggttcggagagggatgacatgtgggagagagtcaaattcttggcatctttatgggcttctatttctaaggatttcaaggattatagtctttcttctattattcttaattggcaagcagccgtagtataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

242

Amino Acids

27.92

Weight (kDa)

9.34

Isoelectric Point (pI)

46.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000842)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15420 FvH4_2g00771 FvH4_3g29363
malus_domestica MD02G1293300.v1.1 MD06G1023000.v1.1 MD09G1232900.v1.1
prunus_persica Prupe.1G181500_v2.0.a1 Prupe.1G572100_v2.0.a1 Prupe.2G095500_v2.0.a1 Prupe.3G150400_v2.0.a1 Prupe.3G156200_v2.0.a1 Prupe.4G274400_v2.0.a1 Prupe.5G070700_v2.0.a1 Prupe.7G038000_v2.0.a1 Prupe.7G164000_v2.0.a1 Prupe.8G056500_v2.0.a1
pyrus_communis pycom04g02040 pycom05g04600 pycom07g05610 pycom08g16130 pycom11g16470 pycom12g07830 pycom15g38190 pycom215g00040
rosa_chinensis RchiOBHm_Chr1g0348881 RchiOBHm_Chr5g0032951 RchiOBHm_Chr6g0273271 RchiOBHm_Chr7g0218191 RchiOBHm_Chr7g0223721
rosa_multiflora Rmu_co8286615.1_g000001 Rmu_sc0001354.1_g000002 Rmu_sc0001925.1_g000003 Rmu_sc0001925.1_g000005 Rmu_sc0002221.1_g000004 Rmu_sc0002316.1_g000096 Rmu_sc0003291.1_g000005 Rmu_sc0003413.1_g000005 Rmu_sc0003542.1_g000011 Rmu_sc0004035.1_g000003 Rmu_sc0004035.1_g000004 Rmu_sc0004145.1_g000016 Rmu_sc0004660.1_g000004 Rmu_sc0005999.1_g000006 Rmu_sc0006123.1_g000002 Rmu_sc0006586.1_g000006 Rmu_sc0006889.1_g000029 Rmu_sc0008035.1_g000014 Rmu_sc0011962.1_g000002 Rmu_sc0029950.1_g000001 Rmu_sc0042409.1_g000001 Rmu_ssc0000238.1_g000013
rosa_roxburghii Rroxscaffold_2G00137410 Rroxscaffold_4G00312010 Rroxscaffold_4G00320800 Rroxscaffold_5G00341720 Rroxscaffold_5G00353530 Rroxscaffold_5G00360290 Rroxscaffold_7G00214170 Rroxscaffold_7G00215920
rosa_rugosa Rorug02G0157000
rosa_samantha Rh4BG196500 Rh6CG346400 Rh7BG241100 Rh7DG316300
rosa_wichuraiana Rw1G003610 Rw7G012170 Rw7G030150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 185
AcsI RAATTY 3 cut(s) 143, 582, 635
AcuI CTGAAG 1 cut(s) 171
AfiI CCNNNNNNNGG 1 cut(s) 241
AflIII ACRYGT 1 cut(s) 618
AgsI TTSAA 4 cut(s) 50, 302, 590, 676
AhlI ACTAGT 1 cut(s) 176
AjiI CACGTC 1 cut(s) 379
AloI GAACNNNNNNTCC 1 cut(s) 34
AluBI AGCT 7 cut(s) 6, 127, 168, 421, 452, 494, 545
AluI AGCT 7 cut(s) 6, 127, 168, 421, 452, 494, 545
AlwI GGATC 1 cut(s) 185
ApeKI GCWGC 1 cut(s) 716
ApoI RAATTY 3 cut(s) 143, 582, 635
Asp700I GAANNNNTTC 1 cut(s) 322
AspS9I GGNCC 1 cut(s) 232
AsuC2I CCSGG 1 cut(s) 315
AsuHPI GGTGA 1 cut(s) 256
AsuNHI GCTAGC 1 cut(s) 541
AvaII GGWCC 1 cut(s) 232
BceAI ACGGC 1 cut(s) 704
BclI TGATCA 1 cut(s) 373
BcnI CCSGG 1 cut(s) 315
BcuI ACTAGT 1 cut(s) 176
BfaI CTAG 3 cut(s) 77, 177, 542
BisI GCNGC 1 cut(s) 717
BlsI GCNGC 1 cut(s) 718
Bme1390I CCNGG 1 cut(s) 315
Bme18I GGWCC 1 cut(s) 232
BmgBI CACGTC 1 cut(s) 379
BmgT120I GGNCC 1 cut(s) 232
BmiI GGNNCC 1 cut(s) 234
BmrFI CCNGG 1 cut(s) 315
BmrI ACTGGG 1 cut(s) 147
BmsI GCATC 2 cut(s) 351, 653
BmtI GCTAGC 1 cut(s) 545
BmuI ACTGGG 1 cut(s) 147
BplI GAGNNNNNCTC 2 cut(s) 44, 76
BpuEI CTTGAG 1 cut(s) 149
BpuMI CCSGG 1 cut(s) 315
BsaJI CCNNGG 1 cut(s) 358
Bsc4I CCNNNNNNNGG 1 cut(s) 241
Bse1I ACTGG 3 cut(s) 142, 341, 449
BseDI CCNNGG 1 cut(s) 358
BseGI GGATG 2 cut(s) 536, 619
BseLI CCNNNNNNNGG 1 cut(s) 241
BseNI ACTGG 3 cut(s) 142, 341, 449
BseRI GAGGAG 1 cut(s) 321
BseYI CCCAGC 1 cut(s) 6
BsiSI CCGG 1 cut(s) 314
BslFI GGGAC 2 cut(s) 23, 218
BslI CCNNNNNNNGG 1 cut(s) 241
BsmFI GGGAC 2 cut(s) 23, 218
Bsp143I GATC 2 cut(s) 190, 373
Bsp19I CCATGG 1 cut(s) 358
BspLI GGNNCC 1 cut(s) 234
BspOI GCTAGC 1 cut(s) 545
BspPI GGATC 1 cut(s) 185
BsrI ACTGG 3 cut(s) 142, 341, 449
BssECI CCNNGG 1 cut(s) 358
BssMI GATC 2 cut(s) 190, 373
BssT1I CCWWGG 1 cut(s) 358
Bst6I CTCTTC 1 cut(s) 45
BstAPI GCANNNNNTGC 1 cut(s) 348
BstC8I GCNNGC 2 cut(s) 543, 714
BstDEI CTNAG 2 cut(s) 476, 666
BstDSI CCRYGG 1 cut(s) 358
BstF5I GGATG 2 cut(s) 536, 619
BstKTI GATC 2 cut(s) 193, 376
BstMBI GATC 2 cut(s) 190, 373
BstMWI GCNNNNNNNGC 1 cut(s) 348
BstNSI RCATGY 1 cut(s) 622
BstSCI CCNGG 1 cut(s) 313
BstX2I RGATCY 1 cut(s) 190
BstYI RGATCY 1 cut(s) 190
BtgI CCRYGG 1 cut(s) 358
BtrI CACGTC 1 cut(s) 379
BtsCI GGATG 2 cut(s) 536, 619
BtsIMutI CAGTG 1 cut(s) 334
Cac8I GCNNGC 2 cut(s) 543, 714
Cfr13I GGNCC 1 cut(s) 232
CviAII CATG 2 cut(s) 359, 619
DdeI CTNAG 2 cut(s) 476, 666
DpnI GATC 2 cut(s) 192, 375
DpnII GATC 2 cut(s) 190, 373
Eam1104I CTCTTC 1 cut(s) 45
EarI CTCTTC 1 cut(s) 45
Eco130I CCWWGG 1 cut(s) 358
Eco47I GGWCC 1 cut(s) 232
Eco57I CTGAAG 1 cut(s) 171
EcoO109I RGGNCCY 1 cut(s) 232
EcoT14I CCWWGG 1 cut(s) 358
ErhI CCWWGG 1 cut(s) 358
FaeI CATG 2 cut(s) 362, 622
FaiI YATR 9 cut(s) 165, 349, 360, 412, 597, 620, 652, 684, 727
FalI AAGNNNNNCTT 2 cut(s) 310, 342
FaqI GGGAC 2 cut(s) 23, 218
FatI CATG 2 cut(s) 358, 618
FbaI TGATCA 1 cut(s) 373
Fnu4HI GCNGC 1 cut(s) 717
FokI GGATG 2 cut(s) 543, 626
Fsp4HI GCNGC 1 cut(s) 717
FspBI CTAG 3 cut(s) 77, 177, 542
GluI GCNGC 1 cut(s) 717
GsaI CCCAGC 1 cut(s) 10
HapII CCGG 1 cut(s) 314
Hin1II CATG 2 cut(s) 362, 622
HindIII AAGCTT 2 cut(s) 125, 419
HinfI GANTC 2 cut(s) 98, 630
HpaII CCGG 1 cut(s) 314
HphI GGTGA 1 cut(s) 256
Hpy166II GTNNAC 1 cut(s) 442
Hpy188I TCNGA 3 cut(s) 89, 190, 607
Hpy188III TCNNGA 1 cut(s) 22
Hpy8I GTNNAC 1 cut(s) 442
HpyAV CCTTC 1 cut(s) 308
HpyCH4IV ACGT 2 cut(s) 225, 378
HpyCH4V TGCA 5 cut(s) 153, 209, 342, 351, 388
HpyF10VI GCNNNNNNNGC 1 cut(s) 348
HpyF3I CTNAG 2 cut(s) 476, 666
HpySE526I ACGT 2 cut(s) 225, 378
Hsp92II CATG 2 cut(s) 362, 622
Ksp22I TGATCA 1 cut(s) 373
Kzo9I GATC 2 cut(s) 190, 373
LmnI GCTCC 1 cut(s) 457
LpnPI CCDG 8 cut(s) 7, 120, 123, 219, 322, 327, 430, 547
LweI GCATC 2 cut(s) 351, 653
MaeI CTAG 3 cut(s) 77, 177, 542
MaeII ACGT 2 cut(s) 225, 378
MaeIII GTNAC 1 cut(s) 397
MalI GATC 2 cut(s) 192, 375
MboI GATC 2 cut(s) 190, 373
MboII GAAGA 6 cut(s) 62, 259, 289, 318, 591, 684
MflI RGATCY 1 cut(s) 190
MluCI AATT 5 cut(s) 143, 470, 582, 635, 706
MlyI GAGTC 2 cut(s) 107, 639
MmeI TCCRAC 1 cut(s) 546
MnlI CCTC 7 cut(s) 46, 70, 111, 342, 424, 593, 603
MroXI GAANNNNTTC 1 cut(s) 322
MseI TTAA 3 cut(s) 32, 173, 705
MslI CAYNNNNRTG 1 cut(s) 649
MspI CCGG 1 cut(s) 314
MspR9I CCNGG 1 cut(s) 315
MwoI GCNNNNNNNGC 1 cut(s) 348
NciI CCSGG 1 cut(s) 315
NcoI CCATGG 1 cut(s) 358
NdeII GATC 2 cut(s) 190, 373
NheI GCTAGC 1 cut(s) 541
NlaIII CATG 2 cut(s) 362, 622
NlaIV GGNNCC 1 cut(s) 234
NmuCI GTSAC 1 cut(s) 397
NspI RCATGY 1 cut(s) 622
PciI ACATGT 1 cut(s) 618
PdmI GAANNNNTTC 1 cut(s) 322
PkrI GCNGC 1 cut(s) 718
PleI GAGTC 2 cut(s) 106, 638
PpsI GAGTC 2 cut(s) 106, 638
PpuMI RGGWCCY 1 cut(s) 232
PscI ACATGT 1 cut(s) 618
Psp5II RGGWCCY 1 cut(s) 232
PspFI CCCAGC 1 cut(s) 6
PspN4I GGNNCC 1 cut(s) 234
PspPI GGNCC 1 cut(s) 232
PspPPI RGGWCCY 1 cut(s) 232
PsuI RGATCY 1 cut(s) 190
RseI CAYNNNNRTG 1 cut(s) 649
SaqAI TTAA 3 cut(s) 32, 173, 705
SatI GCNGC 1 cut(s) 717
Sau3AI GATC 2 cut(s) 190, 373
Sau96I GGNCC 1 cut(s) 232
SchI GAGTC 2 cut(s) 107, 639
ScrFI CCNGG 1 cut(s) 315
SfaNI GCATC 2 cut(s) 351, 653
SinI GGWCC 1 cut(s) 232
SmiMI CAYNNNNRTG 1 cut(s) 649
SmlI CTYRAG 1 cut(s) 128
SmoI CTYRAG 1 cut(s) 128
SpeI ACTAGT 1 cut(s) 176
Sse9I AATT 5 cut(s) 143, 470, 582, 635, 706
SspMI CTAG 3 cut(s) 77, 177, 542
StyD4I CCNGG 1 cut(s) 313
StyI CCWWGG 1 cut(s) 358
TaiI ACGT 2 cut(s) 228, 381
TasI AATT 5 cut(s) 143, 470, 582, 635, 706
Tru1I TTAA 3 cut(s) 32, 173, 705
Tru9I TTAA 3 cut(s) 32, 173, 705
TscAI CASTG 1 cut(s) 341
TseFI GTSAC 1 cut(s) 397
TseI GCWGC 1 cut(s) 716
Tsp45I GTSAC 1 cut(s) 397
TspDTI ATGAA 2 cut(s) 126, 296
TspRI CASTG 1 cut(s) 341
VpaK11BI GGWCC 1 cut(s) 232
XapI RAATTY 3 cut(s) 143, 582, 635
XceI RCATGY 1 cut(s) 622
XmnI GAANNNNTTC 1 cut(s) 322
XspI CTAG 3 cut(s) 77, 177, 542
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.