Rmu_sc0001354.1_g000002

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001354.1
OG0000842
Physical Location & Seq
Reverse (-)
859 .. 1479
621 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001354.1_g000002.1.cds

Sequence Viewer

Length: 504 bp
atggttgttcacaaggctgctactctggaagctatcttcaaagacaacaatccagtgaaggattcttctacccccattcactatggtattatcaagtggactcctcctcctccaggagttttcaaactaaactttgatgggagtgctctaagagaccgcctttatcacccctttcttctcaagtgcaagaaaatcataattgaaggggactcaaagtttgaaggggactcaaagttgatcattgatgctgccagaaataagtgtaccattccttggaagctcaaaaccctcattaaggacatcaggttcctttccgatcaattcgaggaggtctccttcatccacattccctgcgaagccaacttcattgctgatgcagttaccaatcatgcacattcttctccaaacccgacgacgtggaagcaaaagttgttgctttccactctgtctgcttttaattttgatttttttagttctgattgtagtaggggcttggctttgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

167

Amino Acids

18.83

Weight (kDa)

8.66

Isoelectric Point (pI)

30.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000842)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15420 FvH4_2g00771 FvH4_3g29363
malus_domestica MD02G1293300.v1.1 MD06G1023000.v1.1 MD09G1232900.v1.1
prunus_persica Prupe.1G181500_v2.0.a1 Prupe.1G572100_v2.0.a1 Prupe.2G095500_v2.0.a1 Prupe.3G150400_v2.0.a1 Prupe.3G156200_v2.0.a1 Prupe.4G274400_v2.0.a1 Prupe.5G070700_v2.0.a1 Prupe.7G038000_v2.0.a1 Prupe.7G164000_v2.0.a1 Prupe.8G056500_v2.0.a1
pyrus_communis pycom04g02040 pycom05g04600 pycom07g05610 pycom08g16130 pycom11g16470 pycom12g07830 pycom15g38190 pycom215g00040
rosa_chinensis RchiOBHm_Chr1g0348881 RchiOBHm_Chr5g0032951 RchiOBHm_Chr6g0273271 RchiOBHm_Chr7g0218191 RchiOBHm_Chr7g0223721
rosa_multiflora Rmu_co8286615.1_g000001 Rmu_sc0001354.1_g000002 Rmu_sc0001925.1_g000003 Rmu_sc0001925.1_g000005 Rmu_sc0002221.1_g000004 Rmu_sc0002316.1_g000096 Rmu_sc0003291.1_g000005 Rmu_sc0003413.1_g000005 Rmu_sc0003542.1_g000011 Rmu_sc0004035.1_g000003 Rmu_sc0004035.1_g000004 Rmu_sc0004145.1_g000016 Rmu_sc0004660.1_g000004 Rmu_sc0005999.1_g000006 Rmu_sc0006123.1_g000002 Rmu_sc0006586.1_g000006 Rmu_sc0006889.1_g000029 Rmu_sc0008035.1_g000014 Rmu_sc0011962.1_g000002 Rmu_sc0029950.1_g000001 Rmu_sc0042409.1_g000001 Rmu_ssc0000238.1_g000013
rosa_roxburghii Rroxscaffold_2G00137410 Rroxscaffold_4G00312010 Rroxscaffold_4G00320800 Rroxscaffold_5G00341720 Rroxscaffold_5G00353530 Rroxscaffold_5G00360290 Rroxscaffold_7G00214170 Rroxscaffold_7G00215920
rosa_rugosa Rorug02G0157000
rosa_samantha Rh4BG196500 Rh6CG346400 Rh7BG241100 Rh7DG316300
rosa_wichuraiana Rw1G003610 Rw7G012170 Rw7G030150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 273
AciI CCGC 1 cut(s) 157
AfaI GTAC 1 cut(s) 265
AfiI CCNNNNNNNGG 3 cut(s) 113, 273, 295
AgsI TTSAA 4 cut(s) 40, 124, 203, 221
AjiI CACGTC 1 cut(s) 417
AjnI CCWGG 1 cut(s) 112
AloI GAACNNNNNNTCC 2 cut(s) 290, 322
AluBI AGCT 2 cut(s) 32, 280
AluI AGCT 2 cut(s) 32, 280
Alw21I GWGCWC 1 cut(s) 148
Alw26I GTCTC 2 cut(s) 147, 337
ApeKI GCWGC 2 cut(s) 17, 248
ArsI GACNNNNNNTTYG 2 cut(s) 200, 232
AsuHPI GGTGA 1 cut(s) 158
Bbv12I GWGCWC 1 cut(s) 148
BbvI GCAGC 2 cut(s) 4, 235
BccI CCATC 1 cut(s) 131
BciT130I CCWGG 1 cut(s) 114
BclI TGATCA 1 cut(s) 237
BcoDI GTCTC 2 cut(s) 147, 337
BisI GCNGC 2 cut(s) 18, 249
BlsI GCNGC 2 cut(s) 19, 250
Bme1390I CCNGG 1 cut(s) 114
BmgBI CACGTC 1 cut(s) 417
BmiI GGNNCC 1 cut(s) 308
BmrFI CCNGG 1 cut(s) 114
BmsI GCATC 2 cut(s) 235, 364
BplI GAGNNNNNCTC 2 cut(s) 317, 349
BpmI CTGGAG 1 cut(s) 96
BpuEI CTTGAG 1 cut(s) 164
BsaI GGTCTC 2 cut(s) 147, 337
BsaJI CCNNGG 1 cut(s) 272
BsaXI ACNNNNNCTCC 2 cut(s) 91, 121
Bsc4I CCNNNNNNNGG 3 cut(s) 113, 273, 295
Bse1I ACTGG 1 cut(s) 53
Bse3DI GCAATG 1 cut(s) 366
BseBI CCWGG 1 cut(s) 114
BseDI CCNNGG 1 cut(s) 272
BseGI GGATG 1 cut(s) 339
BseLI CCNNNNNNNGG 3 cut(s) 113, 273, 295
BseMI GCAATG 1 cut(s) 366
BseNI ACTGG 1 cut(s) 53
BseRI GAGGAG 4 cut(s) 93, 96, 99, 341
BseXI GCAGC 2 cut(s) 4, 235
BsiHKAI GWGCWC 1 cut(s) 148
BslFI GGGAC 2 cut(s) 221, 239
BslI CCNNNNNNNGG 3 cut(s) 113, 273, 295
BsmAI GTCTC 2 cut(s) 147, 337
BsmFI GGGAC 2 cut(s) 221, 239
Bso31I GGTCTC 2 cut(s) 147, 337
Bsp1286I GDGCHC 1 cut(s) 148
Bsp143I GATC 2 cut(s) 237, 316
BspACI CCGC 1 cut(s) 157
BspLI GGNNCC 1 cut(s) 308
BspTNI GGTCTC 2 cut(s) 147, 337
BsrDI GCAATG 1 cut(s) 366
BsrI ACTGG 1 cut(s) 53
BssECI CCNNGG 1 cut(s) 272
BssMI GATC 2 cut(s) 237, 316
BssT1I CCWWGG 1 cut(s) 272
Bst2UI CCWGG 1 cut(s) 114
BstDEI CTNAG 1 cut(s) 149
BstENI CCTNNNNNAGG 2 cut(s) 111, 293
BstF5I GGATG 1 cut(s) 339
BstKTI GATC 2 cut(s) 240, 319
BstMAI GTCTC 2 cut(s) 147, 337
BstMBI GATC 2 cut(s) 237, 316
BstNI CCWGG 1 cut(s) 114
BstSCI CCNGG 1 cut(s) 112
BstV1I GCAGC 2 cut(s) 4, 235
BtrI CACGTC 1 cut(s) 417
BtsCI GGATG 1 cut(s) 339
BtsIMutI CAGTG 1 cut(s) 60
Csp6I GTAC 1 cut(s) 264
CviAII CATG 1 cut(s) 389
CviJI RGCY 6 cut(s) 17, 32, 280, 359, 492, 497
CviKI_1 RGCY 6 cut(s) 17, 32, 280, 359, 492, 497
CviQI GTAC 1 cut(s) 264
DdeI CTNAG 1 cut(s) 149
DpnI GATC 2 cut(s) 239, 318
DpnII GATC 2 cut(s) 237, 316
Eco130I CCWWGG 1 cut(s) 272
Eco31I GGTCTC 2 cut(s) 147, 337
EcoNI CCTNNNNNAGG 2 cut(s) 111, 293
EcoRII CCWGG 1 cut(s) 112
EcoT14I CCWWGG 1 cut(s) 272
ErhI CCWWGG 1 cut(s) 272
FaeI CATG 1 cut(s) 392
FaiI YATR 3 cut(s) 84, 197, 390
FaqI GGGAC 2 cut(s) 221, 239
FatI CATG 1 cut(s) 388
FbaI TGATCA 1 cut(s) 237
Fnu4HI GCNGC 2 cut(s) 18, 249
FokI GGATG 1 cut(s) 326
Fsp4HI GCNGC 2 cut(s) 18, 249
GluI GCNGC 2 cut(s) 18, 249
GsuI CTGGAG 1 cut(s) 96
Hin1II CATG 1 cut(s) 392
HinfI GANTC 4 cut(s) 62, 100, 209, 227
HphI GGTGA 1 cut(s) 158
Hpy166II GTNNAC 3 cut(s) 10, 99, 264
Hpy188I TCNGA 2 cut(s) 316, 478
Hpy188III TCNNGA 1 cut(s) 26
Hpy8I GTNNAC 3 cut(s) 10, 99, 264
Hpy99I CGWCG 2 cut(s) 415, 418
HpyAV CCTTC 4 cut(s) 52, 197, 215, 346
HpyCH4IV ACGT 1 cut(s) 416
HpyCH4V TGCA 3 cut(s) 186, 377, 392
HpyF3I CTNAG 1 cut(s) 149
HpySE526I ACGT 1 cut(s) 416
Hsp92II CATG 1 cut(s) 392
Ksp22I TGATCA 1 cut(s) 237
Kzo9I GATC 2 cut(s) 237, 316
LpnPI CCDG 7 cut(s) 11, 66, 99, 126, 265, 289, 364
Lsp1109I GCAGC 2 cut(s) 4, 235
LweI GCATC 2 cut(s) 235, 364
MaeII ACGT 1 cut(s) 416
MaeIII GTNAC 1 cut(s) 379
MalI GATC 2 cut(s) 239, 318
MboI GATC 2 cut(s) 237, 316
MboII GAAGA 4 cut(s) 28, 57, 167, 390
MhlI GDGCHC 1 cut(s) 148
MluCI AATT 3 cut(s) 198, 320, 457
MlyI GAGTC 3 cut(s) 94, 203, 221
MnlI CCTC 6 cut(s) 114, 117, 120, 299, 319, 322
MseI TTAA 2 cut(s) 294, 456
MspR9I CCNGG 1 cut(s) 114
MvaI CCWGG 1 cut(s) 114
NdeII GATC 2 cut(s) 237, 316
NlaIII CATG 1 cut(s) 392
NlaIV GGNNCC 1 cut(s) 308
PfeI GAWTC 1 cut(s) 62
PflMI CCANNNNNTGG 1 cut(s) 273
PfoI TCCNGGA 1 cut(s) 112
PkrI GCNGC 2 cut(s) 19, 250
PleI GAGTC 3 cut(s) 94, 203, 221
PpsI GAGTC 3 cut(s) 94, 203, 221
Psp6I CCWGG 1 cut(s) 112
PspGI CCWGG 1 cut(s) 112
PspN4I GGNNCC 1 cut(s) 308
RsaI GTAC 1 cut(s) 265
RsaNI GTAC 1 cut(s) 264
SaqAI TTAA 2 cut(s) 294, 456
SatI GCNGC 2 cut(s) 18, 249
Sau3AI GATC 2 cut(s) 237, 316
SchI GAGTC 3 cut(s) 94, 203, 221
ScrFI CCNGG 1 cut(s) 114
SduI GDGCHC 1 cut(s) 148
SetI ASST 5 cut(s) 34, 282, 308, 333, 419
SfaNI GCATC 2 cut(s) 235, 364
SmlI CTYRAG 1 cut(s) 179
SmoI CTYRAG 1 cut(s) 179
Sse9I AATT 3 cut(s) 198, 320, 457
SsiI CCGC 1 cut(s) 157
StyD4I CCNGG 1 cut(s) 112
StyI CCWWGG 1 cut(s) 272
TaiI ACGT 1 cut(s) 419
TaqI TCGA 1 cut(s) 324
TasI AATT 3 cut(s) 198, 320, 457
TfiI GAWTC 1 cut(s) 62
Tru1I TTAA 2 cut(s) 294, 456
Tru9I TTAA 2 cut(s) 294, 456
TscAI CASTG 1 cut(s) 60
TseI GCWGC 2 cut(s) 17, 248
TspDTI ATGAA 2 cut(s) 328, 355
TspRI CASTG 1 cut(s) 60
Van91I CCANNNNNTGG 1 cut(s) 273
XagI CCTNNNNNAGG 2 cut(s) 111, 293
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.