Rmu_sc0003413.1_g000005

ribonuclease H protein At1g65750

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003413.1
OG0000842
Physical Location & Seq
Reverse (-)
33453 .. 34178
726 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003413.1_g000005.1.cds

Sequence Viewer

Length: 726 bp
atgagctgggattttgggttcagaagaaacttaaatgatcaagagattgaggagtttgcctcgctgatggttaagctagaaaatgtccgattagtggagtccaaaccagatgaaaggaggtggaagcttgagcctaacggaaaattctcttgcaaatctttccatagcttcttaattagtggtggatcagatccattttttgctcctgcaaagtttatttggaaggtcaaggtccctactaaggtgaagattttgggatggcttgtggtactggggaagacgaatacatgtgatcttcttcaaaggagaccgggaagttgtttttctcctcactggtgcattttatgcaaagctcaaggggaaagtgctgatcatgtcttcgtgcattgtgaagtggctaatttcttatggaaaaaattattttgggaggcaagagtggactggacaactccattagagagaagtgacttgctaagagaaaaccccatagcgtttggtaaaggtaaaaaggccagaaccctttggggttgtggggtgctagctgtagtttgggtggtttggatggaaagaaataaaagattacttgaaaactatggaggggtggagaaggaagacctgtgggagagagtcaagttctgggcatccttatgggtttctatttctaaggaattcaaggattataatctctcttccattacatttaactggcaagcagctgtagtataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

241

Amino Acids

28.14

Weight (kDa)

9.14

Isoelectric Point (pI)

42.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000842)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15420 FvH4_2g00771 FvH4_3g29363
malus_domestica MD02G1293300.v1.1 MD06G1023000.v1.1 MD09G1232900.v1.1
prunus_persica Prupe.1G181500_v2.0.a1 Prupe.1G572100_v2.0.a1 Prupe.2G095500_v2.0.a1 Prupe.3G150400_v2.0.a1 Prupe.3G156200_v2.0.a1 Prupe.4G274400_v2.0.a1 Prupe.5G070700_v2.0.a1 Prupe.7G038000_v2.0.a1 Prupe.7G164000_v2.0.a1 Prupe.8G056500_v2.0.a1
pyrus_communis pycom04g02040 pycom05g04600 pycom07g05610 pycom08g16130 pycom11g16470 pycom12g07830 pycom15g38190 pycom215g00040
rosa_chinensis RchiOBHm_Chr1g0348881 RchiOBHm_Chr5g0032951 RchiOBHm_Chr6g0273271 RchiOBHm_Chr7g0218191 RchiOBHm_Chr7g0223721
rosa_multiflora Rmu_co8286615.1_g000001 Rmu_sc0001354.1_g000002 Rmu_sc0001925.1_g000003 Rmu_sc0001925.1_g000005 Rmu_sc0002221.1_g000004 Rmu_sc0002316.1_g000096 Rmu_sc0003291.1_g000005 Rmu_sc0003413.1_g000005 Rmu_sc0003542.1_g000011 Rmu_sc0004035.1_g000003 Rmu_sc0004035.1_g000004 Rmu_sc0004145.1_g000016 Rmu_sc0004660.1_g000004 Rmu_sc0005999.1_g000006 Rmu_sc0006123.1_g000002 Rmu_sc0006586.1_g000006 Rmu_sc0006889.1_g000029 Rmu_sc0008035.1_g000014 Rmu_sc0011962.1_g000002 Rmu_sc0029950.1_g000001 Rmu_sc0042409.1_g000001 Rmu_ssc0000238.1_g000013
rosa_roxburghii Rroxscaffold_2G00137410 Rroxscaffold_4G00312010 Rroxscaffold_4G00320800 Rroxscaffold_5G00341720 Rroxscaffold_5G00353530 Rroxscaffold_5G00360290 Rroxscaffold_7G00214170 Rroxscaffold_7G00215920
rosa_rugosa Rorug02G0157000
rosa_samantha Rh4BG196500 Rh6CG346400 Rh7BG241100 Rh7DG316300
rosa_wichuraiana Rw1G003610 Rw7G012170 Rw7G030150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 681
AclWI GGATC 2 cut(s) 185, 193
AcsI RAATTY 2 cut(s) 143, 668
AfaI GTAC 1 cut(s) 270
AfiI CCNNNNNNNGG 2 cut(s) 94, 241
AflIII ACRYGT 1 cut(s) 287
AgsI TTSAA 3 cut(s) 302, 587, 673
AloI GAACNNNNNNTCC 1 cut(s) 34
AluBI AGCT 7 cut(s) 6, 76, 127, 168, 353, 542, 716
AluI AGCT 7 cut(s) 6, 76, 127, 168, 353, 542, 716
Alw26I GTCTC 1 cut(s) 301
AlwI GGATC 2 cut(s) 185, 193
AoxI GGCC 1 cut(s) 510
ApeKI GCWGC 1 cut(s) 713
ApoI RAATTY 2 cut(s) 143, 668
AspS9I GGNCC 1 cut(s) 232
AsuC2I CCSGG 1 cut(s) 312
AsuHPI GGTGA 1 cut(s) 256
AsuNHI GCTAGC 1 cut(s) 538
AvaII GGWCC 1 cut(s) 232
BbsI GAAGAC 3 cut(s) 284, 370, 618
BccI CCATC 3 cut(s) 61, 252, 556
BclI TGATCA 2 cut(s) 37, 370
BcnI CCSGG 1 cut(s) 312
BcoDI GTCTC 1 cut(s) 301
BfaI CTAG 2 cut(s) 77, 539
BfmI CTRYAG 2 cut(s) 543, 717
BisI GCNGC 1 cut(s) 714
BlsI GCNGC 1 cut(s) 715
Bme1390I CCNGG 1 cut(s) 312
Bme18I GGWCC 1 cut(s) 232
BmgT120I GGNCC 1 cut(s) 232
BmiI GGNNCC 1 cut(s) 234
BmrFI CCNGG 1 cut(s) 312
BmrI ACTGGG 1 cut(s) 281
BmsI GCATC 1 cut(s) 650
BmtI GCTAGC 1 cut(s) 542
BmuI ACTGGG 1 cut(s) 281
BpiI GAAGAC 3 cut(s) 284, 370, 618
BplI GAGNNNNNCTC 2 cut(s) 44, 76
BpuEI CTTGAG 2 cut(s) 149, 339
BpuMI CCSGG 1 cut(s) 312
BsaBI GATNNNNATC 1 cut(s) 681
BsaI GGTCTC 1 cut(s) 301
Bsc4I CCNNNNNNNGG 2 cut(s) 94, 241
Bse1I ACTGG 4 cut(s) 276, 338, 446, 710
Bse8I GATNNNNATC 1 cut(s) 681
BseGI GGATG 3 cut(s) 263, 567, 641
BseJI GATNNNNATC 1 cut(s) 681
BseLI CCNNNNNNNGG 2 cut(s) 94, 241
BseNI ACTGG 4 cut(s) 276, 338, 446, 710
BseRI GAGGAG 2 cut(s) 65, 318
BseYI CCCAGC 1 cut(s) 6
BshFI GGCC 1 cut(s) 512
BsiSI CCGG 1 cut(s) 311
BslFI GGGAC 1 cut(s) 218
BslI CCNNNNNNNGG 2 cut(s) 94, 241
BsmAI GTCTC 1 cut(s) 301
BsmFI GGGAC 1 cut(s) 218
BsnI GGCC 1 cut(s) 512
Bso31I GGTCTC 1 cut(s) 301
Bsp143I GATC 5 cut(s) 37, 185, 190, 292, 370
BspANI GGCC 1 cut(s) 512
BspLI GGNNCC 1 cut(s) 234
BspOI GCTAGC 1 cut(s) 542
BspPI GGATC 2 cut(s) 185, 193
BspTNI GGTCTC 1 cut(s) 301
BsrI ACTGG 4 cut(s) 276, 338, 446, 710
BssMI GATC 5 cut(s) 37, 185, 190, 292, 370
Bst6I CTCTTC 1 cut(s) 694
BstAPI GCANNNNNTGC 1 cut(s) 345
BstC8I GCNNGC 2 cut(s) 540, 711
BstDEI CTNAG 3 cut(s) 240, 473, 663
BstF5I GGATG 3 cut(s) 263, 567, 641
BstKTI GATC 5 cut(s) 40, 188, 193, 295, 373
BstMAI GTCTC 1 cut(s) 301
BstMBI GATC 5 cut(s) 37, 185, 190, 292, 370
BstMWI GCNNNNNNNGC 1 cut(s) 345
BstNSI RCATGY 1 cut(s) 291
BstSCI CCNGG 1 cut(s) 310
BstSFI CTRYAG 2 cut(s) 543, 717
BstV2I GAAGAC 3 cut(s) 284, 370, 618
BstX2I RGATCY 1 cut(s) 190
BstYI RGATCY 1 cut(s) 190
BsuRI GGCC 1 cut(s) 512
BtsCI GGATG 3 cut(s) 263, 567, 641
BtsIMutI CAGTG 1 cut(s) 331
Cac8I GCNNGC 2 cut(s) 540, 711
Cfr13I GGNCC 1 cut(s) 232
Csp6I GTAC 1 cut(s) 269
CviAII CATG 2 cut(s) 288, 374
CviQI GTAC 1 cut(s) 269
DdeI CTNAG 3 cut(s) 240, 473, 663
DpnI GATC 5 cut(s) 39, 187, 192, 294, 372
DpnII GATC 5 cut(s) 37, 185, 190, 292, 370
Eam1104I CTCTTC 1 cut(s) 694
EarI CTCTTC 1 cut(s) 694
Eco31I GGTCTC 1 cut(s) 301
Eco47I GGWCC 1 cut(s) 232
EcoO109I RGGNCCY 1 cut(s) 232
EcoRI GAATTC 1 cut(s) 668
FaeI CATG 2 cut(s) 291, 377
FaqI GGGAC 1 cut(s) 218
FatI CATG 2 cut(s) 287, 373
FbaI TGATCA 2 cut(s) 37, 370
Fnu4HI GCNGC 1 cut(s) 714
FokI GGATG 3 cut(s) 270, 574, 628
Fsp4HI GCNGC 1 cut(s) 714
FspBI CTAG 2 cut(s) 77, 539
GluI GCNGC 1 cut(s) 714
GsaI CCCAGC 1 cut(s) 10
HaeIII GGCC 1 cut(s) 512
HapII CCGG 1 cut(s) 311
Hin1II CATG 2 cut(s) 291, 377
HindIII AAGCTT 1 cut(s) 125
HinfI GANTC 2 cut(s) 98, 627
HpaII CCGG 1 cut(s) 311
HphI GGTGA 1 cut(s) 256
Hpy166II GTNNAC 1 cut(s) 439
Hpy188I TCNGA 3 cut(s) 23, 89, 190
Hpy188III TCNNGA 1 cut(s) 41
Hpy8I GTNNAC 1 cut(s) 439
HpyAV CCTTC 2 cut(s) 217, 601
HpyCH4V TGCA 5 cut(s) 153, 209, 339, 348, 385
HpyF10VI GCNNNNNNNGC 1 cut(s) 345
HpyF3I CTNAG 3 cut(s) 240, 473, 663
Hsp92II CATG 2 cut(s) 291, 377
Ksp22I TGATCA 2 cut(s) 37, 370
Kzo9I GATC 5 cut(s) 37, 185, 190, 292, 370
LmnI GCTCC 1 cut(s) 208
LweI GCATC 1 cut(s) 650
MaeI CTAG 2 cut(s) 77, 539
MaeIII GTNAC 1 cut(s) 464
MalI GATC 5 cut(s) 39, 187, 192, 294, 372
MboI GATC 5 cut(s) 37, 185, 190, 292, 370
MboII GAAGA 8 cut(s) 36, 259, 287, 289, 290, 370, 623, 681
MflI RGATCY 1 cut(s) 190
MluCI AATT 5 cut(s) 143, 174, 400, 416, 668
MlyI GAGTC 2 cut(s) 107, 636
MnlI CCTC 6 cut(s) 43, 70, 111, 339, 421, 590
MseI TTAA 4 cut(s) 32, 72, 173, 702
MslI CAYNNNNRTG 1 cut(s) 646
MspA1I CMGCKG 1 cut(s) 716
MspI CCGG 1 cut(s) 311
MspR9I CCNGG 1 cut(s) 312
MwoI GCNNNNNNNGC 1 cut(s) 345
NciI CCSGG 1 cut(s) 312
NdeII GATC 5 cut(s) 37, 185, 190, 292, 370
NheI GCTAGC 1 cut(s) 538
NlaIII CATG 2 cut(s) 291, 377
NlaIV GGNNCC 1 cut(s) 234
NmuCI GTSAC 1 cut(s) 464
NspI RCATGY 1 cut(s) 291
PciI ACATGT 1 cut(s) 287
PkrI GCNGC 1 cut(s) 715
PleI GAGTC 2 cut(s) 106, 635
PpsI GAGTC 2 cut(s) 106, 635
PpuMI RGGWCCY 1 cut(s) 232
PscI ACATGT 1 cut(s) 287
PsiI TTATAA 1 cut(s) 681
Psp5II RGGWCCY 1 cut(s) 232
PspFI CCCAGC 1 cut(s) 6
PspN4I GGNNCC 1 cut(s) 234
PspPI GGNCC 1 cut(s) 232
PspPPI RGGWCCY 1 cut(s) 232
PsuI RGATCY 1 cut(s) 190
PvuII CAGCTG 1 cut(s) 716
RsaI GTAC 1 cut(s) 270
RsaNI GTAC 1 cut(s) 269
RseI CAYNNNNRTG 1 cut(s) 646
SaqAI TTAA 4 cut(s) 32, 72, 173, 702
SatI GCNGC 1 cut(s) 714
Sau3AI GATC 5 cut(s) 37, 185, 190, 292, 370
Sau96I GGNCC 1 cut(s) 232
SchI GAGTC 2 cut(s) 107, 636
ScrFI CCNGG 1 cut(s) 312
SfaNI GCATC 1 cut(s) 650
SfcI CTRYAG 2 cut(s) 543, 717
SinI GGWCC 1 cut(s) 232
SmiMI CAYNNNNRTG 1 cut(s) 646
SmlI CTYRAG 2 cut(s) 128, 354
SmoI CTYRAG 2 cut(s) 128, 354
Sse9I AATT 5 cut(s) 143, 174, 400, 416, 668
SspMI CTAG 2 cut(s) 77, 539
StyD4I CCNGG 1 cut(s) 310
TasI AATT 5 cut(s) 143, 174, 400, 416, 668
Tru1I TTAA 4 cut(s) 32, 72, 173, 702
Tru9I TTAA 4 cut(s) 32, 72, 173, 702
TscAI CASTG 1 cut(s) 338
TseFI GTSAC 1 cut(s) 464
TseI GCWGC 1 cut(s) 713
Tsp45I GTSAC 1 cut(s) 464
TspDTI ATGAA 1 cut(s) 126
TspGWI ACGGA 1 cut(s) 153
TspRI CASTG 1 cut(s) 338
VpaK11BI GGWCC 1 cut(s) 232
XapI RAATTY 2 cut(s) 143, 668
XceI RCATGY 1 cut(s) 291
XspI CTAG 2 cut(s) 77, 539
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.