Rmu_sc0008035.1_g000014

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008035.1
OG0000842
Physical Location & Seq
Reverse (-)
34496 .. 35119
624 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008035.1_g000014.1.cds

Sequence Viewer

Length: 624 bp
atgctcacccttattcaagctaacctttcaggtatgcctaatcacataatgtcatgctttaaatgcccttcgaaattaacaaattcaattgataaagcttctagaaatttcttatggggctccaactctagttataaccctgttgcttggcaccaagcttgtactccaaaacgtatgggagggttaggcattagaccttctgctcatttcaataatgcggttattgccaaacttggctggaaagtttcaagagcagggaggctcacccttattcaagctaacctttcaggtatgcctaatcacataatgtcatgctttaaatgcccttcgaaattaacaaattctgataaagcttctagaaatttcttatggggctccaactctagttataaccctgttgcttggcaccaagcttgtactccaaaacgtatgggagggttaggcattagaccttctgctcatttcaataatgcggttattgccaaacttggctggaaagttctcacccatccgagtaactggtgggttaagattgttactaaaaaatatcttaaaaatatatctttcttccaagccaagaaaagggcaaaactgctctttagcttggaaaggcatcttagatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

207

Amino Acids

23.21

Weight (kDa)

10.86

Isoelectric Point (pI)

50.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000842)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15420 FvH4_2g00771 FvH4_3g29363
malus_domestica MD02G1293300.v1.1 MD06G1023000.v1.1 MD09G1232900.v1.1
prunus_persica Prupe.1G181500_v2.0.a1 Prupe.1G572100_v2.0.a1 Prupe.2G095500_v2.0.a1 Prupe.3G150400_v2.0.a1 Prupe.3G156200_v2.0.a1 Prupe.4G274400_v2.0.a1 Prupe.5G070700_v2.0.a1 Prupe.7G038000_v2.0.a1 Prupe.7G164000_v2.0.a1 Prupe.8G056500_v2.0.a1
pyrus_communis pycom04g02040 pycom05g04600 pycom07g05610 pycom08g16130 pycom11g16470 pycom12g07830 pycom15g38190 pycom215g00040
rosa_chinensis RchiOBHm_Chr1g0348881 RchiOBHm_Chr5g0032951 RchiOBHm_Chr6g0273271 RchiOBHm_Chr7g0218191 RchiOBHm_Chr7g0223721
rosa_multiflora Rmu_co8286615.1_g000001 Rmu_sc0001354.1_g000002 Rmu_sc0001925.1_g000003 Rmu_sc0001925.1_g000005 Rmu_sc0002221.1_g000004 Rmu_sc0002316.1_g000096 Rmu_sc0003291.1_g000005 Rmu_sc0003413.1_g000005 Rmu_sc0003542.1_g000011 Rmu_sc0004035.1_g000003 Rmu_sc0004035.1_g000004 Rmu_sc0004145.1_g000016 Rmu_sc0004660.1_g000004 Rmu_sc0005999.1_g000006 Rmu_sc0006123.1_g000002 Rmu_sc0006586.1_g000006 Rmu_sc0006889.1_g000029 Rmu_sc0008035.1_g000014 Rmu_sc0011962.1_g000002 Rmu_sc0029950.1_g000001 Rmu_sc0042409.1_g000001 Rmu_ssc0000238.1_g000013
rosa_roxburghii Rroxscaffold_2G00137410 Rroxscaffold_4G00312010 Rroxscaffold_4G00320800 Rroxscaffold_5G00341720 Rroxscaffold_5G00353530 Rroxscaffold_5G00360290 Rroxscaffold_7G00214170 Rroxscaffold_7G00215920
rosa_rugosa Rorug02G0157000
rosa_samantha Rh4BG196500 Rh6CG346400 Rh7BG241100 Rh7DG316300
rosa_wichuraiana Rw1G003610 Rw7G012170 Rw7G030150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 135, 390
AccB1I GGYRCC 2 cut(s) 150, 405
AciI CCGC 2 cut(s) 218, 473
AcsI RAATTY 4 cut(s) 82, 106, 340, 361
AfaI GTAC 2 cut(s) 163, 418
AfiI CCNNNNNNNGG 1 cut(s) 582
AgsI TTSAA 6 cut(s) 17, 87, 211, 249, 275, 466
AluBI AGCT 7 cut(s) 20, 98, 158, 278, 353, 413, 603
AluI AGCT 7 cut(s) 20, 98, 158, 278, 353, 413, 603
ApoI RAATTY 4 cut(s) 82, 106, 340, 361
AsuHPI GGTGA 2 cut(s) 256, 496
AsuII TTCGAA 2 cut(s) 71, 329
BanI GGYRCC 2 cut(s) 150, 405
BanII GRGCYC 2 cut(s) 122, 377
BccI CCATC 1 cut(s) 516
BfaI CTAG 4 cut(s) 102, 129, 357, 384
BmiI GGNNCC 4 cut(s) 121, 152, 376, 407
Bpu14I TTCGAA 2 cut(s) 71, 329
Bsc4I CCNNNNNNNGG 1 cut(s) 582
Bse1I ACTGG 1 cut(s) 524
BseGI GGATG 1 cut(s) 508
BseLI CCNNNNNNNGG 1 cut(s) 582
BseNI ACTGG 1 cut(s) 524
BshNI GGYRCC 2 cut(s) 150, 405
BslI CCNNNNNNNGG 1 cut(s) 582
Bsp119I TTCGAA 2 cut(s) 71, 329
Bsp1286I GDGCHC 2 cut(s) 122, 377
BspACI CCGC 2 cut(s) 218, 473
BspLI GGNNCC 4 cut(s) 121, 152, 376, 407
BspT104I TTCGAA 2 cut(s) 71, 329
BspT107I GGYRCC 2 cut(s) 150, 405
BsrI ACTGG 1 cut(s) 524
BstBI TTCGAA 2 cut(s) 71, 329
BstDEI CTNAG 1 cut(s) 617
BstF5I GGATG 1 cut(s) 508
BstMWI GCNNNNNNNGC 4 cut(s) 63, 224, 321, 479
BtsCI GGATG 1 cut(s) 508
Csp6I GTAC 2 cut(s) 162, 417
CviAII CATG 2 cut(s) 54, 312
CviQI GTAC 2 cut(s) 162, 417
DdeI CTNAG 1 cut(s) 617
DraI TTTAAA 2 cut(s) 61, 319
Eco24I GRGCYC 2 cut(s) 122, 377
EcoT38I GRGCYC 2 cut(s) 122, 377
FaeI CATG 2 cut(s) 57, 315
FalI AAGNNNNNCTT 4 cut(s) 9, 41, 267, 299
FatI CATG 2 cut(s) 53, 311
FokI GGATG 1 cut(s) 495
FriOI GRGCYC 2 cut(s) 122, 377
FspBI CTAG 4 cut(s) 102, 129, 357, 384
Hin1II CATG 2 cut(s) 57, 315
HindIII AAGCTT 4 cut(s) 96, 156, 351, 411
HphI GGTGA 2 cut(s) 256, 496
Hpy188I TCNGA 2 cut(s) 346, 513
Hpy188III TCNNGA 3 cut(s) 102, 249, 357
HpyAV CCTTC 4 cut(s) 78, 207, 336, 462
HpyCH4IV ACGT 2 cut(s) 172, 427
HpyF10VI GCNNNNNNNGC 4 cut(s) 63, 224, 321, 479
HpyF3I CTNAG 1 cut(s) 617
HpySE526I ACGT 2 cut(s) 172, 427
Hsp92II CATG 2 cut(s) 57, 315
LmnI GCTCC 2 cut(s) 125, 380
LpnPI CCDG 8 cut(s) 15, 153, 223, 240, 273, 408, 478, 505
MaeI CTAG 4 cut(s) 102, 129, 357, 384
MaeII ACGT 2 cut(s) 172, 427
MaeIII GTNAC 2 cut(s) 515, 535
MboII GAAGA 1 cut(s) 559
MfeI CAATTG 1 cut(s) 87
MhlI GDGCHC 2 cut(s) 122, 377
MluCI AATT 7 cut(s) 74, 82, 87, 106, 332, 340, 361
MmeI TCCRAC 2 cut(s) 147, 402
MnlI CCTC 3 cut(s) 173, 252, 428
MseI TTAA 6 cut(s) 60, 77, 318, 335, 528, 552
MunI CAATTG 1 cut(s) 87
MwoI GCNNNNNNNGC 4 cut(s) 63, 224, 321, 479
NlaIII CATG 2 cut(s) 57, 315
NlaIV GGNNCC 4 cut(s) 121, 152, 376, 407
NspV TTCGAA 2 cut(s) 71, 329
PsiI TTATAA 2 cut(s) 135, 390
PspN4I GGNNCC 4 cut(s) 121, 152, 376, 407
RsaI GTAC 2 cut(s) 163, 418
RsaNI GTAC 2 cut(s) 162, 417
SaqAI TTAA 6 cut(s) 60, 77, 318, 335, 528, 552
SduI GDGCHC 2 cut(s) 122, 377
SfuI TTCGAA 2 cut(s) 71, 329
Sse9I AATT 7 cut(s) 74, 82, 87, 106, 332, 340, 361
SsiI CCGC 2 cut(s) 218, 473
SspMI CTAG 4 cut(s) 102, 129, 357, 384
TaiI ACGT 2 cut(s) 175, 430
TaqI TCGA 2 cut(s) 71, 329
TasI AATT 7 cut(s) 74, 82, 87, 106, 332, 340, 361
TatI WGTACW 2 cut(s) 161, 416
Tru1I TTAA 6 cut(s) 60, 77, 318, 335, 528, 552
Tru9I TTAA 6 cut(s) 60, 77, 318, 335, 528, 552
XapI RAATTY 4 cut(s) 82, 106, 340, 361
XbaI TCTAGA 2 cut(s) 101, 356
XspI CTAG 4 cut(s) 102, 129, 357, 384
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.