Rmu_sc0005999.1_g000006

ribonuclease H protein At1g65750

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005999.1
OG0000842
Physical Location & Seq
Forward (+)
29397 .. 31129
1733 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005999.1_g000006.1.cds

Sequence Viewer

Length: 738 bp
atgccgcggggccgcgaggatgctgcggagatgccacgagtgtgcgtggggaaagccgattgttcacgggggcagaaggcaaggagggcttgtgggcgctgcaggggcagcgaggctaacttggtagggttagcgttgagttgcaacacgggggcagtggtagcaccggggaggctaatccgaagaaacttaaatgatcaagagattgaggagtttgcctcactgatggttaaactagaaaatgtccgattagtggagtccaaaccagatgaaaggaggtggaagcttgagcctaatgggaaattctcttggaaatccttccattgcttcttaattagtggtggatcagatccaatttttgctcctgcaaagtttatttggaaggtcaaggtccctactaaggtgaagattttgggatggcttgtggtactgtggaagacgaatacatgtgatgttcttcaaaggagaagaccgagaagttgtttttctcctcactggtgcattttatgcaaagctcaaggggaaaatgatgatcatgtcttcgtgcattgtgaagtggctaatttcttatggaaaaaattatttagggaggcaagagtggactggacaactccattagagagaagtgacttgctaagagaaaccatagcgtttggtaaaggtaaaaaggccagaaccctttggggttgtggggtgctagctagctgtagtttgggtgctctggatagaaagaaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

245

Amino Acids

27.76

Weight (kDa)

9.7

Isoelectric Point (pI)

46.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000842)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15420 FvH4_2g00771 FvH4_3g29363
malus_domestica MD02G1293300.v1.1 MD06G1023000.v1.1 MD09G1232900.v1.1
prunus_persica Prupe.1G181500_v2.0.a1 Prupe.1G572100_v2.0.a1 Prupe.2G095500_v2.0.a1 Prupe.3G150400_v2.0.a1 Prupe.3G156200_v2.0.a1 Prupe.4G274400_v2.0.a1 Prupe.5G070700_v2.0.a1 Prupe.7G038000_v2.0.a1 Prupe.7G164000_v2.0.a1 Prupe.8G056500_v2.0.a1
pyrus_communis pycom04g02040 pycom05g04600 pycom07g05610 pycom08g16130 pycom11g16470 pycom12g07830 pycom15g38190 pycom215g00040
rosa_chinensis RchiOBHm_Chr1g0348881 RchiOBHm_Chr5g0032951 RchiOBHm_Chr6g0273271 RchiOBHm_Chr7g0218191 RchiOBHm_Chr7g0223721
rosa_multiflora Rmu_co8286615.1_g000001 Rmu_sc0001354.1_g000002 Rmu_sc0001925.1_g000003 Rmu_sc0001925.1_g000005 Rmu_sc0002221.1_g000004 Rmu_sc0002316.1_g000096 Rmu_sc0003291.1_g000005 Rmu_sc0003413.1_g000005 Rmu_sc0003542.1_g000011 Rmu_sc0004035.1_g000003 Rmu_sc0004035.1_g000004 Rmu_sc0004145.1_g000016 Rmu_sc0004660.1_g000004 Rmu_sc0005999.1_g000006 Rmu_sc0006123.1_g000002 Rmu_sc0006586.1_g000006 Rmu_sc0006889.1_g000029 Rmu_sc0008035.1_g000014 Rmu_sc0011962.1_g000002 Rmu_sc0029950.1_g000001 Rmu_sc0042409.1_g000001 Rmu_ssc0000238.1_g000013
rosa_roxburghii Rroxscaffold_2G00137410 Rroxscaffold_4G00312010 Rroxscaffold_4G00320800 Rroxscaffold_5G00341720 Rroxscaffold_5G00353530 Rroxscaffold_5G00360290 Rroxscaffold_7G00214170 Rroxscaffold_7G00215920
rosa_rugosa Rorug02G0157000
rosa_samantha Rh4BG196500 Rh6CG346400 Rh7BG241100 Rh7DG316300
rosa_wichuraiana Rw1G003610 Rw7G012170 Rw7G030150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 7, 15
AciI CCGC 4 cut(s) 5, 7, 13, 26
AclWI GGATC 2 cut(s) 344, 352
AcsI RAATTY 1 cut(s) 302
AfaI GTAC 1 cut(s) 429
AfiI CCNNNNNNNGG 2 cut(s) 253, 400
AflIII ACRYGT 1 cut(s) 446
AgsI TTSAA 1 cut(s) 461
AleI CACNNNNGTG 1 cut(s) 40
AluBI AGCT 4 cut(s) 286, 515, 701, 705
AluI AGCT 4 cut(s) 286, 515, 701, 705
Alw21I GWGCWC 1 cut(s) 721
AlwI GGATC 2 cut(s) 344, 352
AoxI GGCC 2 cut(s) 10, 669
ApeKI GCWGC 3 cut(s) 23, 99, 108
ApoI RAATTY 1 cut(s) 302
Asp700I GAANNNNTTC 1 cut(s) 317
AspLEI GCGC 1 cut(s) 99
AspS9I GGNCC 2 cut(s) 10, 391
AsuC2I CCSGG 1 cut(s) 168
AsuHPI GGTGA 1 cut(s) 415
AsuNHI GCTAGC 2 cut(s) 697, 701
AvaII GGWCC 1 cut(s) 391
BauI CACGAG 1 cut(s) 36
BbsI GAAGAC 3 cut(s) 443, 475, 532
Bbv12I GWGCWC 1 cut(s) 721
BbvI GCAGC 3 cut(s) 10, 86, 120
BccI CCATC 2 cut(s) 220, 411
BcgI CGANNNNNNTGC 2 cut(s) 5, 39
BclI TGATCA 2 cut(s) 196, 532
BcnI CCSGG 1 cut(s) 168
BfaI CTAG 3 cut(s) 236, 698, 702
BfmI CTRYAG 2 cut(s) 100, 706
BfoI RGCGCY 1 cut(s) 100
BisI GCNGC 5 cut(s) 5, 13, 24, 100, 109
BlsI GCNGC 5 cut(s) 6, 14, 25, 101, 110
Bme1390I CCNGG 1 cut(s) 168
Bme18I GGWCC 1 cut(s) 391
BmgT120I GGNCC 2 cut(s) 10, 391
BmiI GGNNCC 2 cut(s) 11, 393
BmrFI CCNGG 1 cut(s) 168
BmsI GCATC 2 cut(s) 10, 21
BmtI GCTAGC 2 cut(s) 701, 705
BpiI GAAGAC 3 cut(s) 443, 475, 532
BplI GAGNNNNNCTC 2 cut(s) 203, 235
BpuEI CTTGAG 2 cut(s) 308, 501
BpuMI CCSGG 1 cut(s) 168
BsaJI CCNNGG 2 cut(s) 5, 167
BsaXI ACNNNNNCTCC 2 cut(s) 76, 106
Bsc4I CCNNNNNNNGG 2 cut(s) 253, 400
Bse1I ACTGG 2 cut(s) 500, 608
Bse3DI GCAATG 1 cut(s) 322
BseDI CCNNGG 2 cut(s) 5, 167
BseGI GGATG 2 cut(s) 25, 422
BseLI CCNNNNNNNGG 2 cut(s) 253, 400
BseMI GCAATG 1 cut(s) 322
BseNI ACTGG 2 cut(s) 500, 608
BseRI GAGGAG 2 cut(s) 224, 480
BseXI GCAGC 3 cut(s) 10, 86, 120
Bsh1236I CGCG 2 cut(s) 7, 15
BshFI GGCC 2 cut(s) 12, 671
BsiHKAI GWGCWC 1 cut(s) 721
BsiSI CCGG 1 cut(s) 167
BslFI GGGAC 1 cut(s) 377
BslI CCNNNNNNNGG 2 cut(s) 253, 400
BsmFI GGGAC 1 cut(s) 377
BsnI GGCC 2 cut(s) 12, 671
Bsp1286I GDGCHC 1 cut(s) 721
Bsp143I GATC 4 cut(s) 196, 344, 349, 532
BspACI CCGC 4 cut(s) 5, 7, 13, 26
BspANI GGCC 2 cut(s) 12, 671
BspFNI CGCG 2 cut(s) 7, 15
BspLI GGNNCC 2 cut(s) 11, 393
BspMAI CTGCAG 1 cut(s) 104
BspOI GCTAGC 2 cut(s) 701, 705
BspPI GGATC 2 cut(s) 344, 352
BsrDI GCAATG 1 cut(s) 322
BsrI ACTGG 2 cut(s) 500, 608
BssECI CCNNGG 2 cut(s) 5, 167
BssMI GATC 4 cut(s) 196, 344, 349, 532
BssSI CACGAG 1 cut(s) 36
Bst2BI CACGAG 1 cut(s) 36
Bst4CI ACNGT 1 cut(s) 432
BstAPI GCANNNNNTGC 1 cut(s) 507
BstC8I GCNNGC 2 cut(s) 699, 703
BstDEI CTNAG 2 cut(s) 399, 635
BstDSI CCRYGG 1 cut(s) 5
BstF5I GGATG 2 cut(s) 25, 422
BstFNI CGCG 2 cut(s) 7, 15
BstH2I RGCGCY 1 cut(s) 100
BstHHI GCGC 1 cut(s) 99
BstKTI GATC 4 cut(s) 199, 347, 352, 535
BstMBI GATC 4 cut(s) 196, 344, 349, 532
BstMWI GCNNNNNNNGC 5 cut(s) 86, 105, 108, 161, 507
BstNSI RCATGY 1 cut(s) 450
BstSCI CCNGG 1 cut(s) 166
BstSFI CTRYAG 2 cut(s) 100, 706
BstUI CGCG 2 cut(s) 7, 15
BstV1I GCAGC 3 cut(s) 10, 86, 120
BstV2I GAAGAC 3 cut(s) 443, 475, 532
BstX2I RGATCY 1 cut(s) 349
BstYI RGATCY 1 cut(s) 349
BsuRI GGCC 2 cut(s) 12, 671
BtgI CCRYGG 1 cut(s) 5
BtsCI GGATG 2 cut(s) 25, 422
BtsI GCAGTG 1 cut(s) 162
BtsIMutI CAGTG 3 cut(s) 162, 221, 493
Cac8I GCNNGC 2 cut(s) 699, 703
CfoI GCGC 1 cut(s) 99
Cfr13I GGNCC 2 cut(s) 10, 391
Cfr42I CCGCGG 1 cut(s) 8
Csp6I GTAC 1 cut(s) 428
CviAII CATG 2 cut(s) 447, 536
CviQI GTAC 1 cut(s) 428
DdeI CTNAG 2 cut(s) 399, 635
DpnI GATC 4 cut(s) 198, 346, 351, 534
DpnII GATC 4 cut(s) 196, 344, 349, 532
Eco47I GGWCC 1 cut(s) 391
EcoO109I RGGNCCY 1 cut(s) 391
FaeI CATG 2 cut(s) 450, 539
FaiI YATR 5 cut(s) 448, 508, 537, 571, 647
FalI AAGNNNNNCTT 2 cut(s) 73, 105
FaqI GGGAC 1 cut(s) 377
FatI CATG 2 cut(s) 446, 535
FbaI TGATCA 2 cut(s) 196, 532
Fnu4HI GCNGC 5 cut(s) 5, 13, 24, 100, 109
FokI GGATG 2 cut(s) 32, 429
Fsp4HI GCNGC 5 cut(s) 5, 13, 24, 100, 109
FspBI CTAG 3 cut(s) 236, 698, 702
GlaI GCGC 1 cut(s) 98
GluI GCNGC 5 cut(s) 5, 13, 24, 100, 109
HaeII RGCGCY 1 cut(s) 100
HaeIII GGCC 2 cut(s) 12, 671
HapII CCGG 1 cut(s) 167
HhaI GCGC 1 cut(s) 99
Hin1II CATG 2 cut(s) 450, 539
Hin6I GCGC 1 cut(s) 97
HinP1I GCGC 1 cut(s) 97
HindIII AAGCTT 1 cut(s) 284
HinfI GANTC 1 cut(s) 257
HpaII CCGG 1 cut(s) 167
HphI GGTGA 1 cut(s) 415
Hpy166II GTNNAC 2 cut(s) 65, 601
Hpy188I TCNGA 3 cut(s) 182, 248, 349
Hpy188III TCNNGA 2 cut(s) 200, 722
Hpy8I GTNNAC 2 cut(s) 65, 601
HpyAV CCTTC 3 cut(s) 70, 328, 376
HpyCH4III ACNGT 1 cut(s) 432
HpyCH4V TGCA 6 cut(s) 102, 144, 368, 501, 510, 547
HpyF10VI GCNNNNNNNGC 5 cut(s) 86, 105, 108, 161, 507
HpyF3I CTNAG 2 cut(s) 399, 635
Hsp92II CATG 2 cut(s) 450, 539
HspAI GCGC 1 cut(s) 97
Ksp22I TGATCA 2 cut(s) 196, 532
KspI CCGCGG 1 cut(s) 8
Kzo9I GATC 4 cut(s) 196, 344, 349, 532
LmnI GCTCC 1 cut(s) 367
LpnPI CCDG 8 cut(s) 88, 180, 279, 378, 481, 589, 685, 707
Lsp1109I GCAGC 3 cut(s) 10, 86, 120
LweI GCATC 2 cut(s) 10, 21
MaeI CTAG 3 cut(s) 236, 698, 702
MaeIII GTNAC 1 cut(s) 626
MalI GATC 4 cut(s) 198, 346, 351, 534
MboI GATC 4 cut(s) 196, 344, 349, 532
MboII GAAGA 6 cut(s) 195, 418, 448, 449, 480, 532
MflI RGATCY 1 cut(s) 349
MhlI GDGCHC 1 cut(s) 721
MluCI AATT 5 cut(s) 302, 333, 354, 562, 578
MlyI GAGTC 1 cut(s) 266
MnlI CCTC 9 cut(s) 10, 78, 106, 165, 202, 229, 270, 501, 583
MroXI GAANNNNTTC 1 cut(s) 317
MseI TTAA 3 cut(s) 191, 231, 332
MslI CAYNNNNRTG 1 cut(s) 40
MspA1I CMGCKG 1 cut(s) 7
MspI CCGG 1 cut(s) 167
MspR9I CCNGG 1 cut(s) 168
MvnI CGCG 2 cut(s) 7, 15
MwoI GCNNNNNNNGC 5 cut(s) 86, 105, 108, 161, 507
NciI CCSGG 1 cut(s) 168
NdeII GATC 4 cut(s) 196, 344, 349, 532
NheI GCTAGC 2 cut(s) 697, 701
NlaIII CATG 2 cut(s) 450, 539
NlaIV GGNNCC 2 cut(s) 11, 393
NmuCI GTSAC 1 cut(s) 626
NspI RCATGY 1 cut(s) 450
OliI CACNNNNGTG 1 cut(s) 40
PciI ACATGT 1 cut(s) 446
PdmI GAANNNNTTC 1 cut(s) 317
PkrI GCNGC 5 cut(s) 6, 14, 25, 101, 110
PleI GAGTC 1 cut(s) 265
PpsI GAGTC 1 cut(s) 265
PpuMI RGGWCCY 1 cut(s) 391
PscI ACATGT 1 cut(s) 446
Psp5II RGGWCCY 1 cut(s) 391
PspN4I GGNNCC 2 cut(s) 11, 393
PspPI GGNCC 2 cut(s) 10, 391
PspPPI RGGWCCY 1 cut(s) 391
PstI CTGCAG 1 cut(s) 104
PsuI RGATCY 1 cut(s) 349
RsaI GTAC 1 cut(s) 429
RsaNI GTAC 1 cut(s) 428
RseI CAYNNNNRTG 1 cut(s) 40
SacII CCGCGG 1 cut(s) 8
SaqAI TTAA 3 cut(s) 191, 231, 332
SatI GCNGC 5 cut(s) 5, 13, 24, 100, 109
Sau3AI GATC 4 cut(s) 196, 344, 349, 532
Sau96I GGNCC 2 cut(s) 10, 391
SchI GAGTC 1 cut(s) 266
ScrFI CCNGG 1 cut(s) 168
SduI GDGCHC 1 cut(s) 721
SetI ASST 9 cut(s) 281, 288, 387, 393, 405, 517, 664, 703, 707
SfaNI GCATC 2 cut(s) 10, 21
SfcI CTRYAG 2 cut(s) 100, 706
Sfr303I CCGCGG 1 cut(s) 8
SgrBI CCGCGG 1 cut(s) 8
SinI GGWCC 1 cut(s) 391
SmiMI CAYNNNNRTG 1 cut(s) 40
SmlI CTYRAG 2 cut(s) 287, 516
SmoI CTYRAG 2 cut(s) 287, 516
Sse9I AATT 5 cut(s) 302, 333, 354, 562, 578
SsiI CCGC 4 cut(s) 5, 7, 13, 26
SspMI CTAG 3 cut(s) 236, 698, 702
StyD4I CCNGG 1 cut(s) 166
TaaI ACNGT 1 cut(s) 432
TaqII GACCGA 1 cut(s) 487
TasI AATT 5 cut(s) 302, 333, 354, 562, 578
TauI GCSGC 2 cut(s) 7, 15
Tru1I TTAA 3 cut(s) 191, 231, 332
Tru9I TTAA 3 cut(s) 191, 231, 332
TscAI CASTG 3 cut(s) 162, 228, 500
TseFI GTSAC 1 cut(s) 626
TseI GCWGC 3 cut(s) 23, 99, 108
Tsp45I GTSAC 1 cut(s) 626
TspDTI ATGAA 1 cut(s) 285
TspRI CASTG 3 cut(s) 162, 228, 500
VpaK11BI GGWCC 1 cut(s) 391
XapI RAATTY 1 cut(s) 302
XceI RCATGY 1 cut(s) 450
XmnI GAANNNNTTC 1 cut(s) 317
XspI CTAG 3 cut(s) 236, 698, 702
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.