Rmu_sc0001925.1_g000005

ribonuclease H protein At1g65750

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001925.1
OG0000842
Physical Location & Seq
Reverse (-)
18134 .. 18769
636 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001925.1_g000005.1.cds

Sequence Viewer

Length: 636 bp
atggaacaaaccagtagcatgcaggcattcaatgacttcattagggaaacaagtctctgtgatccaagtcttcttagagcagagttcacatggtccaacttaagggagaatgccatatggtgtagacttgacaggttcttatactctacagattgggagtccatgttcccaaactcaagacaactagctcttacgagagtcacctcggatcacttcccgattttacttgacacaattagtgttaaatggggccctgcaccgttcagatttgaaaacatgtggctggagcacccttccttcaaagagaaatttagaaactggtgggatgaaggaagctgcgatggctggacaggtttcagattcatgagaaagctcaaaaatgtgaaagaaaatttaaagacatggagtagagagaattttggtgacatggggaaagaaaagaaagaggtggcagcaagaataaacgagctagatgaggaagaaagaagtgcaagtatttgtgtggtcaaaaaaagggagagggaagttttaagagggcagttggaggaattagccctaaaagaagagattttctggaggcaaagagccaagttaacatgggccaaagaaggagatcaacacaagcttcttccataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

211

Amino Acids

25.29

Weight (kDa)

6.86

Isoelectric Point (pI)

30.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000842)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15420 FvH4_2g00771 FvH4_3g29363
malus_domestica MD02G1293300.v1.1 MD06G1023000.v1.1 MD09G1232900.v1.1
prunus_persica Prupe.1G181500_v2.0.a1 Prupe.1G572100_v2.0.a1 Prupe.2G095500_v2.0.a1 Prupe.3G150400_v2.0.a1 Prupe.3G156200_v2.0.a1 Prupe.4G274400_v2.0.a1 Prupe.5G070700_v2.0.a1 Prupe.7G038000_v2.0.a1 Prupe.7G164000_v2.0.a1 Prupe.8G056500_v2.0.a1
pyrus_communis pycom04g02040 pycom05g04600 pycom07g05610 pycom08g16130 pycom11g16470 pycom12g07830 pycom15g38190 pycom215g00040
rosa_chinensis RchiOBHm_Chr1g0348881 RchiOBHm_Chr5g0032951 RchiOBHm_Chr6g0273271 RchiOBHm_Chr7g0218191 RchiOBHm_Chr7g0223721
rosa_multiflora Rmu_co8286615.1_g000001 Rmu_sc0001354.1_g000002 Rmu_sc0001925.1_g000003 Rmu_sc0001925.1_g000005 Rmu_sc0002221.1_g000004 Rmu_sc0002316.1_g000096 Rmu_sc0003291.1_g000005 Rmu_sc0003413.1_g000005 Rmu_sc0003542.1_g000011 Rmu_sc0004035.1_g000003 Rmu_sc0004035.1_g000004 Rmu_sc0004145.1_g000016 Rmu_sc0004660.1_g000004 Rmu_sc0005999.1_g000006 Rmu_sc0006123.1_g000002 Rmu_sc0006586.1_g000006 Rmu_sc0006889.1_g000029 Rmu_sc0008035.1_g000014 Rmu_sc0011962.1_g000002 Rmu_sc0029950.1_g000001 Rmu_sc0042409.1_g000001 Rmu_ssc0000238.1_g000013
rosa_roxburghii Rroxscaffold_2G00137410 Rroxscaffold_4G00312010 Rroxscaffold_4G00320800 Rroxscaffold_5G00341720 Rroxscaffold_5G00353530 Rroxscaffold_5G00360290 Rroxscaffold_7G00214170 Rroxscaffold_7G00215920
rosa_rugosa Rorug02G0157000
rosa_samantha Rh4BG196500 Rh6CG346400 Rh7BG241100 Rh7DG316300
rosa_wichuraiana Rw1G003610 Rw7G012170 Rw7G030150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 124
AclWI GGATC 2 cut(s) 56, 216
AcsI RAATTY 3 cut(s) 308, 391, 415
AfiI CCNNNNNNNGG 1 cut(s) 102
AflII CTTAAG 1 cut(s) 100
AflIII ACRYGT 1 cut(s) 276
AgsI TTSAA 3 cut(s) 31, 272, 301
AloI GAACNNNNNNTCC 2 cut(s) 149, 181
AluBI AGCT 5 cut(s) 188, 336, 373, 469, 625
AluI AGCT 5 cut(s) 188, 336, 373, 469, 625
Alw21I GWGCWC 1 cut(s) 291
Alw26I GTCTC 1 cut(s) 59
AlwI GGATC 2 cut(s) 56, 216
AoxI GGCC 2 cut(s) 250, 600
ApaI GGGCCC 1 cut(s) 254
ApeKI GCWGC 2 cut(s) 336, 452
ApoI RAATTY 3 cut(s) 308, 391, 415
AspS9I GGNCC 4 cut(s) 93, 250, 251, 600
AsuHPI GGTGA 2 cut(s) 193, 434
AvaII GGWCC 1 cut(s) 93
BaeGI GKGCMC 1 cut(s) 254
BanII GRGCYC 1 cut(s) 254
BbsI GAAGAC 1 cut(s) 62
Bbv12I GWGCWC 1 cut(s) 291
BbvI GCAGC 2 cut(s) 323, 464
BccI CCATC 1 cut(s) 335
BcoDI GTCTC 1 cut(s) 59
BfaI CTAG 2 cut(s) 185, 470
BfmI CTRYAG 1 cut(s) 147
BfrI CTTAAG 1 cut(s) 100
BisI GCNGC 2 cut(s) 337, 453
BlsI GCNGC 2 cut(s) 338, 454
Bme18I GGWCC 1 cut(s) 93
BmgT120I GGNCC 4 cut(s) 93, 250, 251, 600
BmiI GGNNCC 2 cut(s) 251, 252
BpiI GAAGAC 1 cut(s) 62
BpmI CTGGAG 2 cut(s) 305, 595
BpuEI CTTGAG 1 cut(s) 160
BsaJI CCNNGG 1 cut(s) 204
BsaXI ACNNNNNCTCC 2 cut(s) 149, 179
Bsc4I CCNNNNNNNGG 1 cut(s) 102
Bse1I ACTGG 2 cut(s) 12, 323
BseDI CCNNGG 1 cut(s) 204
BseGI GGATG 1 cut(s) 331
BseLI CCNNNNNNNGG 1 cut(s) 102
BseNI ACTGG 2 cut(s) 12, 323
BseSI GKGCMC 1 cut(s) 254
BseXI GCAGC 2 cut(s) 323, 464
BsgI GTGCAG 1 cut(s) 240
BshFI GGCC 2 cut(s) 252, 602
BsiHKAI GWGCWC 1 cut(s) 291
BslI CCNNNNNNNGG 1 cut(s) 102
BsmAI GTCTC 1 cut(s) 59
BsmI GAATGC 2 cut(s) 26, 115
BsnI GGCC 2 cut(s) 252, 602
Bsp120I GGGCCC 1 cut(s) 250
Bsp1286I GDGCHC 2 cut(s) 254, 291
Bsp143I GATC 3 cut(s) 61, 208, 613
BspANI GGCC 2 cut(s) 252, 602
BspHI TCATGA 1 cut(s) 363
BspLI GGNNCC 2 cut(s) 251, 252
BspPI GGATC 2 cut(s) 56, 216
BspTI CTTAAG 1 cut(s) 100
BsrI ACTGG 2 cut(s) 12, 323
BssECI CCNNGG 1 cut(s) 204
BssMI GATC 3 cut(s) 61, 208, 613
Bst4CI ACNGT 1 cut(s) 261
Bst6I CTCTTC 1 cut(s) 558
BstAFI CTTAAG 1 cut(s) 100
BstC8I GCNNGC 2 cut(s) 20, 24
BstDEI CTNAG 1 cut(s) 74
BstF5I GGATG 1 cut(s) 331
BstKTI GATC 3 cut(s) 64, 211, 616
BstMAI GTCTC 1 cut(s) 59
BstMBI GATC 3 cut(s) 61, 208, 613
BstMWI GCNNNNNNNGC 1 cut(s) 342
BstNSI RCATGY 2 cut(s) 22, 280
BstSFI CTRYAG 1 cut(s) 147
BstSLI GKGCMC 1 cut(s) 254
BstV1I GCAGC 2 cut(s) 323, 464
BstV2I GAAGAC 1 cut(s) 62
BsuRI GGCC 2 cut(s) 252, 602
BtgZI GCGATG 1 cut(s) 354
BtsCI GGATG 1 cut(s) 331
Cac8I GCNNGC 2 cut(s) 20, 24
CciI TCATGA 1 cut(s) 363
Cfr13I GGNCC 4 cut(s) 93, 250, 251, 600
CviAII CATG 8 cut(s) 19, 90, 163, 277, 364, 402, 427, 597
DdeI CTNAG 1 cut(s) 74
DpnI GATC 3 cut(s) 63, 210, 615
DpnII GATC 3 cut(s) 61, 208, 613
DraI TTTAAA 1 cut(s) 396
Eam1104I CTCTTC 1 cut(s) 558
EarI CTCTTC 1 cut(s) 558
Eco24I GRGCYC 1 cut(s) 254
Eco47I GGWCC 1 cut(s) 93
EcoO109I RGGNCCY 2 cut(s) 250, 251
EcoT38I GRGCYC 1 cut(s) 254
FaeI CATG 8 cut(s) 22, 93, 166, 280, 367, 405, 430, 600
FatI CATG 8 cut(s) 18, 89, 162, 276, 363, 401, 426, 596
FauNDI CATATG 1 cut(s) 116
FblI GTMKAC 1 cut(s) 124
Fnu4HI GCNGC 2 cut(s) 337, 453
FokI GGATG 1 cut(s) 338
FriOI GRGCYC 1 cut(s) 254
Fsp4HI GCNGC 2 cut(s) 337, 453
FspBI CTAG 2 cut(s) 185, 470
GluI GCNGC 2 cut(s) 337, 453
GsuI CTGGAG 2 cut(s) 305, 595
HaeIII GGCC 2 cut(s) 252, 602
Hin1II CATG 8 cut(s) 22, 93, 166, 280, 367, 405, 430, 600
HincII GTYRAC 1 cut(s) 594
HindII GTYRAC 1 cut(s) 594
HindIII AAGCTT 1 cut(s) 623
HinfI GANTC 3 cut(s) 158, 198, 360
HpaI GTTAAC 1 cut(s) 594
HphI GGTGA 2 cut(s) 193, 434
Hpy166II GTNNAC 3 cut(s) 87, 125, 594
Hpy188I TCNGA 3 cut(s) 208, 266, 359
Hpy188III TCNNGA 4 cut(s) 177, 217, 364, 574
Hpy8I GTNNAC 3 cut(s) 87, 125, 594
HpyAV CCTTC 4 cut(s) 303, 307, 323, 602
HpyCH4III ACNGT 1 cut(s) 261
HpyCH4V TGCA 3 cut(s) 22, 257, 491
HpyF10VI GCNNNNNNNGC 1 cut(s) 342
HpyF3I CTNAG 1 cut(s) 74
Hsp92II CATG 8 cut(s) 22, 93, 166, 280, 367, 405, 430, 600
KspAI GTTAAC 1 cut(s) 594
Kzo9I GATC 3 cut(s) 61, 208, 613
LmnI GCTCC 1 cut(s) 286
LpnPI CCDG 9 cut(s) 8, 25, 118, 267, 269, 304, 331, 336, 559
Lsp1109I GCAGC 2 cut(s) 323, 464
MaeI CTAG 2 cut(s) 185, 470
MaeIII GTNAC 2 cut(s) 199, 422
MalI GATC 3 cut(s) 63, 210, 615
MboI GATC 3 cut(s) 61, 208, 613
MboII GAAGA 4 cut(s) 62, 491, 575, 620
MhlI GDGCHC 2 cut(s) 254, 291
MluCI AATT 5 cut(s) 234, 308, 391, 415, 548
MlyI GAGTC 2 cut(s) 167, 207
MmeI TCCRAC 2 cut(s) 120, 522
MnlI CCTC 7 cut(s) 214, 439, 469, 513, 527, 538, 570
MseI TTAA 5 cut(s) 101, 243, 395, 530, 593
MspCI CTTAAG 1 cut(s) 100
Mva1269I GAATGC 2 cut(s) 26, 115
MwoI GCNNNNNNNGC 1 cut(s) 342
NdeI CATATG 1 cut(s) 116
NdeII GATC 3 cut(s) 61, 208, 613
NlaIII CATG 8 cut(s) 22, 93, 166, 280, 367, 405, 430, 600
NlaIV GGNNCC 2 cut(s) 251, 252
NmuCI GTSAC 2 cut(s) 199, 422
NspI RCATGY 2 cut(s) 22, 280
PaeI GCATGC 1 cut(s) 22
PagI TCATGA 1 cut(s) 363
PciI ACATGT 1 cut(s) 276
PctI GAATGC 2 cut(s) 26, 115
PfeI GAWTC 1 cut(s) 360
PkrI GCNGC 2 cut(s) 338, 454
PleI GAGTC 2 cut(s) 166, 206
PpsI GAGTC 2 cut(s) 166, 206
PscI ACATGT 1 cut(s) 276
PspN4I GGNNCC 2 cut(s) 251, 252
PspOMI GGGCCC 1 cut(s) 250
PspPI GGNCC 4 cut(s) 93, 250, 251, 600
SaqAI TTAA 5 cut(s) 101, 243, 395, 530, 593
SatI GCNGC 2 cut(s) 337, 453
Sau3AI GATC 3 cut(s) 61, 208, 613
Sau96I GGNCC 4 cut(s) 93, 250, 251, 600
SchI GAGTC 2 cut(s) 167, 207
SduI GDGCHC 2 cut(s) 254, 291
SetI ASST 9 cut(s) 137, 190, 206, 338, 355, 375, 450, 471, 627
SfcI CTRYAG 1 cut(s) 147
SinI GGWCC 1 cut(s) 93
SmlI CTYRAG 2 cut(s) 100, 175
SmoI CTYRAG 2 cut(s) 100, 175
SphI GCATGC 1 cut(s) 22
Sse9I AATT 5 cut(s) 234, 308, 391, 415, 548
SspMI CTAG 2 cut(s) 185, 470
TaaI ACNGT 1 cut(s) 261
TasI AATT 5 cut(s) 234, 308, 391, 415, 548
TfiI GAWTC 1 cut(s) 360
Tru1I TTAA 5 cut(s) 101, 243, 395, 530, 593
Tru9I TTAA 5 cut(s) 101, 243, 395, 530, 593
TseFI GTSAC 2 cut(s) 199, 422
TseI GCWGC 2 cut(s) 336, 452
Tsp45I GTSAC 2 cut(s) 199, 422
TspDTI ATGAA 3 cut(s) 28, 342, 352
Vha464I CTTAAG 1 cut(s) 100
VpaK11BI GGWCC 1 cut(s) 93
XapI RAATTY 3 cut(s) 308, 391, 415
XceI RCATGY 2 cut(s) 22, 280
XmiI GTMKAC 1 cut(s) 124
XspI CTAG 2 cut(s) 185, 470
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.