Rmu_sc0042409.1_g000001

acid phosphatase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0042409.1
Physical Location & Seq
Forward (+)
1140 .. 1844
705 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0042409.1_g000001.1.cds

Sequence Viewer

Length: 705 bp
atggcatcccccagttcaaatgtcttattggagaatgacaggaagatcaaggaagaactagctcaagtttacagagatgaggaactttttttggcccaaaaggcaaaggcaaactggctctcgctgggtgataaaaacactagattctttcaaacccaattcaacatcagaaggaaacaaaaccacattaatggagtcaaggacaccagaggaatctggcttgacgaccctgttcaaatctcagcgttctttatccaagaatttaaatcgagatttacttgtaatagtcaaccaagtctggccgatatcaacaacttcattacacatatacctgaatgcattactaatgaagataatgatctcttactgaagcaagtgatagaagaggaaatctggaaagccctcaattcaattggtccaatcaaagctctaggacccgatggtctgcatgcaatgttctaccagaagtgctggaacaaggtaaggtcaactgtcattcccataataaaaggtttctttgcttcaaatacacctttagctgacctcaaccatacaaatatagcccttatccctaaggtggagaaccctgaatttgtctctcaatttcaacctatcagcttgtgtaatgttagttacacgatcatcaccaaaatcctaattaataggctgggacccttgttggagaaatgcatctccaaaaattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

234

Amino Acids

26.75

Weight (kDa)

8.23

Isoelectric Point (pI)

38.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000842)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15420 FvH4_2g00771 FvH4_3g29363
malus_domestica MD02G1293300.v1.1 MD06G1023000.v1.1 MD09G1232900.v1.1
prunus_persica Prupe.1G181500_v2.0.a1 Prupe.1G572100_v2.0.a1 Prupe.2G095500_v2.0.a1 Prupe.3G150400_v2.0.a1 Prupe.3G156200_v2.0.a1 Prupe.4G274400_v2.0.a1 Prupe.5G070700_v2.0.a1 Prupe.7G038000_v2.0.a1 Prupe.7G164000_v2.0.a1 Prupe.8G056500_v2.0.a1
pyrus_communis pycom04g02040 pycom05g04600 pycom07g05610 pycom08g16130 pycom11g16470 pycom12g07830 pycom15g38190 pycom215g00040
rosa_chinensis RchiOBHm_Chr1g0348881 RchiOBHm_Chr5g0032951 RchiOBHm_Chr6g0273271 RchiOBHm_Chr7g0218191 RchiOBHm_Chr7g0223721
rosa_multiflora Rmu_co8286615.1_g000001 Rmu_sc0001354.1_g000002 Rmu_sc0001925.1_g000003 Rmu_sc0001925.1_g000005 Rmu_sc0002221.1_g000004 Rmu_sc0002316.1_g000096 Rmu_sc0003291.1_g000005 Rmu_sc0003413.1_g000005 Rmu_sc0003542.1_g000011 Rmu_sc0004035.1_g000003 Rmu_sc0004035.1_g000004 Rmu_sc0004145.1_g000016 Rmu_sc0004660.1_g000004 Rmu_sc0005999.1_g000006 Rmu_sc0006123.1_g000002 Rmu_sc0006586.1_g000006 Rmu_sc0006889.1_g000029 Rmu_sc0008035.1_g000014 Rmu_sc0011962.1_g000002 Rmu_sc0029950.1_g000001 Rmu_sc0042409.1_g000001 Rmu_ssc0000238.1_g000013
rosa_roxburghii Rroxscaffold_2G00137410 Rroxscaffold_4G00312010 Rroxscaffold_4G00320800 Rroxscaffold_5G00341720 Rroxscaffold_5G00353530 Rroxscaffold_5G00360290 Rroxscaffold_7G00214170 Rroxscaffold_7G00215920
rosa_rugosa Rorug02G0157000
rosa_samantha Rh4BG196500 Rh6CG346400 Rh7BG241100 Rh7DG316300
rosa_wichuraiana Rw1G003610 Rw7G012170 Rw7G030150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 441
AcoI YGGCCR 1 cut(s) 300
AcsI RAATTY 2 cut(s) 260, 590
AcuI CTGAAG 1 cut(s) 389
AfiI CCNNNNNNNGG 1 cut(s) 577
AgsI TTSAA 7 cut(s) 18, 152, 163, 236, 411, 525, 608
AluBI AGCT 4 cut(s) 62, 428, 539, 618
AluI AGCT 4 cut(s) 62, 428, 539, 618
Alw26I GTCTC 1 cut(s) 601
AoxI GGCC 2 cut(s) 93, 300
ApoI RAATTY 2 cut(s) 260, 590
AseI ATTAAT 2 cut(s) 189, 660
AspS9I GGNCC 4 cut(s) 94, 416, 434, 671
AsuHPI GGTGA 2 cut(s) 140, 637
AvaII GGWCC 3 cut(s) 416, 434, 671
AxyI CCTNAGG 1 cut(s) 573
BccI CCATC 1 cut(s) 434
BcoDI GTCTC 1 cut(s) 601
BfaI CTAG 3 cut(s) 59, 141, 431
BglI GCCNNNNNGGC 1 cut(s) 101
Bme18I GGWCC 3 cut(s) 416, 434, 671
BmgT120I GGNCC 4 cut(s) 94, 416, 434, 671
BmiI GGNNCC 3 cut(s) 436, 672, 673
BmrI ACTGGG 1 cut(s) 6
BmsI GCATC 2 cut(s) 14, 699
BmuI ACTGGG 1 cut(s) 6
BpuEI CTTGAG 1 cut(s) 48
BsaBI GATNNNNATC 1 cut(s) 357
Bsc4I CCNNNNNNNGG 1 cut(s) 577
Bse1I ACTGG 2 cut(s) 12, 119
Bse21I CCTNAGG 1 cut(s) 573
Bse3DI GCAATG 1 cut(s) 459
Bse8I GATNNNNATC 1 cut(s) 357
BseGI GGATG 1 cut(s) 5
BseJI GATNNNNATC 1 cut(s) 357
BseLI CCNNNNNNNGG 1 cut(s) 577
BseMI GCAATG 1 cut(s) 459
BseMII CTCAG 1 cut(s) 255
BseNI ACTGG 2 cut(s) 12, 119
BseYI CCCAGC 2 cut(s) 124, 667
BshFI GGCC 2 cut(s) 95, 302
BslFI GGGAC 1 cut(s) 684
BslI CCNNNNNNNGG 1 cut(s) 577
BsmAI GTCTC 1 cut(s) 601
BsmFI GGGAC 1 cut(s) 684
BsmI GAATGC 1 cut(s) 341
BsnI GGCC 2 cut(s) 95, 302
Bsp143I GATC 3 cut(s) 45, 358, 639
BspANI GGCC 2 cut(s) 95, 302
BspCNI CTCAG 1 cut(s) 254
BspLI GGNNCC 3 cut(s) 436, 672, 673
BsrDI GCAATG 1 cut(s) 459
BsrI ACTGG 2 cut(s) 12, 119
BssMI GATC 3 cut(s) 45, 358, 639
Bst4CI ACNGT 1 cut(s) 493
Bst6I CTCTTC 1 cut(s) 378
BstC8I GCNNGC 1 cut(s) 450
BstDEI CTNAG 2 cut(s) 241, 573
BstF5I GGATG 1 cut(s) 5
BstKTI GATC 3 cut(s) 48, 361, 642
BstMAI GTCTC 1 cut(s) 601
BstMBI GATC 3 cut(s) 45, 358, 639
BstMWI GCNNNNNNNGC 1 cut(s) 101
BstNSI RCATGY 1 cut(s) 452
BstXI CCANNNNNNTGG 1 cut(s) 191
Bsu36I CCTNAGG 1 cut(s) 573
BsuRI GGCC 2 cut(s) 95, 302
BtsCI GGATG 1 cut(s) 5
Cac8I GCNNGC 1 cut(s) 450
Cfr13I GGNCC 4 cut(s) 94, 416, 434, 671
CviAII CATG 1 cut(s) 449
DdeI CTNAG 2 cut(s) 241, 573
DpnI GATC 3 cut(s) 47, 360, 641
DpnII GATC 3 cut(s) 45, 358, 639
DraI TTTAAA 1 cut(s) 265
DrdI GACNNNNNNGTC 1 cut(s) 441
DseDI GACNNNNNNGTC 1 cut(s) 441
EaeI YGGCCR 1 cut(s) 300
Eam1104I CTCTTC 1 cut(s) 378
EarI CTCTTC 1 cut(s) 378
Eco32I GATATC 1 cut(s) 307
Eco47I GGWCC 3 cut(s) 416, 434, 671
Eco57I CTGAAG 1 cut(s) 389
Eco81I CCTNAGG 1 cut(s) 573
EcoO109I RGGNCCY 2 cut(s) 434, 671
EcoRV GATATC 1 cut(s) 307
EcoT22I ATGCAT 2 cut(s) 341, 692
FaeI CATG 1 cut(s) 452
FaiI YATR 6 cut(s) 327, 329, 450, 503, 552, 560
FaqI GGGAC 1 cut(s) 684
FatI CATG 1 cut(s) 448
FspBI CTAG 3 cut(s) 59, 141, 431
GsaI CCCAGC 2 cut(s) 128, 671
HaeIII GGCC 2 cut(s) 95, 302
Hin1II CATG 1 cut(s) 452
HincII GTYRAC 2 cut(s) 290, 489
HindII GTYRAC 2 cut(s) 290, 489
HinfI GANTC 3 cut(s) 144, 195, 213
HphI GGTGA 2 cut(s) 140, 637
Hpy166II GTNNAC 3 cut(s) 70, 290, 489
Hpy188I TCNGA 1 cut(s) 170
Hpy188III TCNNGA 2 cut(s) 270, 394
Hpy8I GTNNAC 3 cut(s) 70, 290, 489
HpyAV CCTTC 1 cut(s) 165
HpyCH4III ACNGT 1 cut(s) 493
HpyCH4V TGCA 4 cut(s) 339, 448, 452, 690
HpyF10VI GCNNNNNNNGC 1 cut(s) 101
HpyF3I CTNAG 2 cut(s) 241, 573
Hsp92II CATG 1 cut(s) 452
KflI GGGWCCC 1 cut(s) 671
Kzo9I GATC 3 cut(s) 45, 358, 639
LweI GCATC 2 cut(s) 14, 699
MaeI CTAG 3 cut(s) 59, 141, 431
MaeIII GTNAC 1 cut(s) 632
MalI GATC 3 cut(s) 47, 360, 641
MboI GATC 3 cut(s) 45, 358, 639
MboII GAAGA 4 cut(s) 55, 65, 362, 395
MfeI CAATTG 1 cut(s) 411
MluCI AATT 8 cut(s) 158, 260, 406, 411, 590, 602, 657, 700
MlyI GAGTC 1 cut(s) 204
MmeI TCCRAC 1 cut(s) 660
MnlI CCTC 5 cut(s) 73, 203, 379, 413, 554
Mph1103I ATGCAT 2 cut(s) 341, 692
MseI TTAA 4 cut(s) 189, 264, 660, 703
MslI CAYNNNNRTG 1 cut(s) 189
MunI CAATTG 1 cut(s) 411
Mva1269I GAATGC 1 cut(s) 341
MwoI GCNNNNNNNGC 1 cut(s) 101
NdeII GATC 3 cut(s) 45, 358, 639
NlaIII CATG 1 cut(s) 452
NlaIV GGNNCC 3 cut(s) 436, 672, 673
NsiI ATGCAT 2 cut(s) 341, 692
NspI RCATGY 1 cut(s) 452
PaeI GCATGC 1 cut(s) 452
PctI GAATGC 1 cut(s) 341
PfeI GAWTC 2 cut(s) 144, 213
PleI GAGTC 1 cut(s) 203
PpsI GAGTC 1 cut(s) 203
PpuMI RGGWCCY 2 cut(s) 434, 671
PshBI ATTAAT 2 cut(s) 189, 660
Psp5II RGGWCCY 2 cut(s) 434, 671
PspFI CCCAGC 2 cut(s) 124, 667
PspN4I GGNNCC 3 cut(s) 436, 672, 673
PspPI GGNCC 4 cut(s) 94, 416, 434, 671
PspPPI RGGWCCY 2 cut(s) 434, 671
RseI CAYNNNNRTG 1 cut(s) 189
SaqAI TTAA 4 cut(s) 189, 264, 660, 703
Sau3AI GATC 3 cut(s) 45, 358, 639
Sau96I GGNCC 4 cut(s) 94, 416, 434, 671
SchI GAGTC 1 cut(s) 204
SfaNI GCATC 2 cut(s) 14, 699
SinI GGWCC 3 cut(s) 416, 434, 671
SmiI ATTTAAAT 1 cut(s) 265
SmiMI CAYNNNNRTG 1 cut(s) 189
SmlI CTYRAG 1 cut(s) 63
SmoI CTYRAG 1 cut(s) 63
SphI GCATGC 1 cut(s) 452
Sse9I AATT 8 cut(s) 158, 260, 406, 411, 590, 602, 657, 700
SspMI CTAG 3 cut(s) 59, 141, 431
SwaI ATTTAAAT 1 cut(s) 265
TaaI ACNGT 1 cut(s) 493
TaqI TCGA 1 cut(s) 269
TasI AATT 8 cut(s) 158, 260, 406, 411, 590, 602, 657, 700
TfiI GAWTC 2 cut(s) 144, 213
Tru1I TTAA 4 cut(s) 189, 264, 660, 703
Tru9I TTAA 4 cut(s) 189, 264, 660, 703
TspDTI ATGAA 2 cut(s) 307, 363
VpaK11BI GGWCC 3 cut(s) 416, 434, 671
VspI ATTAAT 2 cut(s) 189, 660
XapI RAATTY 2 cut(s) 260, 590
XceI RCATGY 1 cut(s) 452
XspI CTAG 3 cut(s) 59, 141, 431
Zsp2I ATGCAT 2 cut(s) 341, 692
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.