Rmu_sc0001925.1_g000003

ribonuclease H protein At1g65750

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001925.1
OG0000842
Physical Location & Seq
Reverse (-)
15551 .. 16540
990 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001925.1_g000003.1.cds

Sequence Viewer

Length: 990 bp
atgggtgggactcaaagccaatctcaggtggatcaagtagaaggtggatcaagtagaagtccttggaaggatatttcagcaggaataagcaaattttcccttggtcataaactaattgtaggcaatggcaaaagagtgaggttctgggaagattcttggctagatgatcagcccttgaaattccagtttccaaggatgttcagattgtcaagatacaacaactactcagtggaaaggttagccaccactctcacttatccgatgagctgggattttgggttcagaagaaatttaaacgaccatgagattgatgagtttgcctcgttggtgggtaagctagaaaatgtccgattagtggagtcaaaaccggatgaaaggagatggcagcttgagcctactgggaaattctctggtaaatccttccactgcttcttaactagtggtggatcagacccaatttttgttcctgcaaagtttatttggagcatcaaggttcctactaaggtgaagattttgggttggcttgtggcactggggaagacgaatacatgtgatgtccttcaaaagagaagaccaggaagttgtctgtctccccactggtgcatcttatgcaaaaaccacgaggagagtgctgatcatgtgtttgtgcgttgtcaagtggctattttcttatggaataagatatttagggaggcaagagtggactgcacaattccattagagagaagcgttctgctgagagaaaaccctctagcttttggcaaagggaaaaaggccagaactctttggggctgtggggtgctagctataatttgggtgatctggatggaaagaaacaaaagactatttgaaaattatggaggagtggagagggaagacatgtgggagagagtcaagttctgggcatccttatgggcttctatctctaaggagttcaaggattataatctctcatccatcattcttaactggcaagcagttgtagtataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

329

Amino Acids

38.1

Weight (kDa)

9.43

Isoelectric Point (pI)

42.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000842)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15420 FvH4_2g00771 FvH4_3g29363
malus_domestica MD02G1293300.v1.1 MD06G1023000.v1.1 MD09G1232900.v1.1
prunus_persica Prupe.1G181500_v2.0.a1 Prupe.1G572100_v2.0.a1 Prupe.2G095500_v2.0.a1 Prupe.3G150400_v2.0.a1 Prupe.3G156200_v2.0.a1 Prupe.4G274400_v2.0.a1 Prupe.5G070700_v2.0.a1 Prupe.7G038000_v2.0.a1 Prupe.7G164000_v2.0.a1 Prupe.8G056500_v2.0.a1
pyrus_communis pycom04g02040 pycom05g04600 pycom07g05610 pycom08g16130 pycom11g16470 pycom12g07830 pycom15g38190 pycom215g00040
rosa_chinensis RchiOBHm_Chr1g0348881 RchiOBHm_Chr5g0032951 RchiOBHm_Chr6g0273271 RchiOBHm_Chr7g0218191 RchiOBHm_Chr7g0223721
rosa_multiflora Rmu_co8286615.1_g000001 Rmu_sc0001354.1_g000002 Rmu_sc0001925.1_g000003 Rmu_sc0001925.1_g000005 Rmu_sc0002221.1_g000004 Rmu_sc0002316.1_g000096 Rmu_sc0003291.1_g000005 Rmu_sc0003413.1_g000005 Rmu_sc0003542.1_g000011 Rmu_sc0004035.1_g000003 Rmu_sc0004035.1_g000004 Rmu_sc0004145.1_g000016 Rmu_sc0004660.1_g000004 Rmu_sc0005999.1_g000006 Rmu_sc0006123.1_g000002 Rmu_sc0006586.1_g000006 Rmu_sc0006889.1_g000029 Rmu_sc0008035.1_g000014 Rmu_sc0011962.1_g000002 Rmu_sc0029950.1_g000001 Rmu_sc0042409.1_g000001 Rmu_ssc0000238.1_g000013
rosa_roxburghii Rroxscaffold_2G00137410 Rroxscaffold_4G00312010 Rroxscaffold_4G00320800 Rroxscaffold_5G00341720 Rroxscaffold_5G00353530 Rroxscaffold_5G00360290 Rroxscaffold_7G00214170 Rroxscaffold_7G00215920
rosa_rugosa Rorug02G0157000
rosa_samantha Rh4BG196500 Rh6CG346400 Rh7BG241100 Rh7DG316300
rosa_wichuraiana Rw1G003610 Rw7G012170 Rw7G030150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 945
AclWI GGATC 3 cut(s) 39, 55, 454
AcsI RAATTY 4 cut(s) 92, 179, 289, 404
AfiI CCNNNNNNNGG 2 cut(s) 25, 355
AflIII ACRYGT 2 cut(s) 548, 879
AgsI TTSAA 4 cut(s) 178, 563, 851, 937
AhlI ACTAGT 1 cut(s) 437
AjnI CCWGG 1 cut(s) 574
AloI GAACNNNNNNTCC 2 cut(s) 263, 295
AluBI AGCT 5 cut(s) 267, 337, 388, 755, 806
AluI AGCT 5 cut(s) 267, 337, 388, 755, 806
Alw26I GTCTC 1 cut(s) 594
AlwI GGATC 3 cut(s) 39, 55, 454
AoxI GGCC 1 cut(s) 774
ApeKI GCWGC 1 cut(s) 385
ApoI RAATTY 4 cut(s) 92, 179, 289, 404
ArsI GACNNNNNNTTYG 2 cut(s) 443, 475
AsuHPI GGTGA 2 cut(s) 517, 829
AsuNHI GCTAGC 1 cut(s) 802
BauI CACGAG 1 cut(s) 620
BbsI GAAGAC 3 cut(s) 545, 577, 882
BbvI GCAGC 1 cut(s) 397
BccI CCATC 3 cut(s) 375, 820, 965
BcgI CGANNNNNNTGC 2 cut(s) 611, 645
BciT130I CCWGG 1 cut(s) 576
BclI TGATCA 2 cut(s) 166, 634
BcoDI GTCTC 1 cut(s) 594
BcuI ACTAGT 1 cut(s) 437
BfaI CTAG 5 cut(s) 161, 338, 438, 752, 803
BisI GCNGC 1 cut(s) 386
BlsI GCNGC 1 cut(s) 387
Bme1390I CCNGG 1 cut(s) 576
BmiI GGNNCC 1 cut(s) 495
BmrFI CCNGG 1 cut(s) 576
BmrI ACTGGG 2 cut(s) 408, 542
BmsI GCATC 3 cut(s) 495, 612, 914
BmtI GCTAGC 1 cut(s) 806
BmuI ACTGGG 2 cut(s) 408, 542
BpiI GAAGAC 3 cut(s) 545, 577, 882
BplI GAGNNNNNCTC 2 cut(s) 305, 337
BpuEI CTTGAG 1 cut(s) 410
BsaBI GATNNNNATC 1 cut(s) 945
BsaJI CCNNGG 3 cut(s) 62, 100, 191
BsaWI WCCGGW 1 cut(s) 367
Bsc4I CCNNNNNNNGG 2 cut(s) 25, 355
Bse1I ACTGG 5 cut(s) 184, 403, 537, 602, 974
Bse3DI GCAATG 1 cut(s) 130
Bse8I GATNNNNATC 1 cut(s) 945
BseBI CCWGG 1 cut(s) 576
BseDI CCNNGG 3 cut(s) 62, 100, 191
BseGI GGATG 5 cut(s) 201, 376, 831, 905, 953
BseJI GATNNNNATC 1 cut(s) 945
BseLI CCNNNNNNNGG 2 cut(s) 25, 355
BseMI GCAATG 1 cut(s) 130
BseMII CTCAG 3 cut(s) 38, 240, 728
BseNI ACTGG 5 cut(s) 184, 403, 537, 602, 974
BseRI GAGGAG 2 cut(s) 638, 876
BseXI GCAGC 1 cut(s) 397
BseYI CCCAGC 1 cut(s) 267
BsgI GTGCAG 1 cut(s) 691
BshFI GGCC 1 cut(s) 776
BsiSI CCGG 1 cut(s) 368
BslFI GGGAC 1 cut(s) 22
BslI CCNNNNNNNGG 2 cut(s) 25, 355
BsmAI GTCTC 1 cut(s) 594
BsmFI GGGAC 1 cut(s) 22
BsnI GGCC 1 cut(s) 776
Bsp143I GATC 6 cut(s) 31, 47, 166, 446, 634, 819
BspANI GGCC 1 cut(s) 776
BspCNI CTCAG 3 cut(s) 37, 239, 729
BspLI GGNNCC 1 cut(s) 495
BspOI GCTAGC 1 cut(s) 806
BspPI GGATC 3 cut(s) 39, 55, 454
BsrDI GCAATG 1 cut(s) 130
BsrI ACTGG 5 cut(s) 184, 403, 537, 602, 974
BssECI CCNNGG 3 cut(s) 62, 100, 191
BssMI GATC 6 cut(s) 31, 47, 166, 446, 634, 819
BssSI CACGAG 1 cut(s) 620
BssT1I CCWWGG 3 cut(s) 62, 100, 191
Bst2BI CACGAG 1 cut(s) 620
Bst2UI CCWGG 1 cut(s) 576
BstAPI GCANNNNNTGC 1 cut(s) 609
BstC8I GCNNGC 2 cut(s) 804, 975
BstDEI CTNAG 5 cut(s) 24, 226, 501, 737, 927
BstF5I GGATG 5 cut(s) 201, 376, 831, 905, 953
BstKTI GATC 6 cut(s) 34, 50, 169, 449, 637, 822
BstMAI GTCTC 1 cut(s) 594
BstMBI GATC 6 cut(s) 31, 47, 166, 446, 634, 819
BstMWI GCNNNNNNNGC 2 cut(s) 391, 609
BstNI CCWGG 1 cut(s) 576
BstNSI RCATGY 2 cut(s) 552, 883
BstSCI CCNGG 1 cut(s) 574
BstV1I GCAGC 1 cut(s) 397
BstV2I GAAGAC 3 cut(s) 545, 577, 882
BsuRI GGCC 1 cut(s) 776
BtsCI GGATG 5 cut(s) 201, 376, 831, 905, 953
BtsI GCAGTG 1 cut(s) 424
BtsIMutI CAGTG 4 cut(s) 234, 424, 530, 595
Cac8I GCNNGC 2 cut(s) 804, 975
CviAII CATG 4 cut(s) 302, 549, 638, 880
DdeI CTNAG 5 cut(s) 24, 226, 501, 737, 927
DpnI GATC 6 cut(s) 33, 49, 168, 448, 636, 821
DpnII GATC 6 cut(s) 31, 47, 166, 446, 634, 819
DraI TTTAAA 1 cut(s) 294
Eco130I CCWWGG 3 cut(s) 62, 100, 191
EcoRII CCWGG 1 cut(s) 574
EcoT14I CCWWGG 3 cut(s) 62, 100, 191
ErhI CCWWGG 3 cut(s) 62, 100, 191
FaeI CATG 4 cut(s) 305, 552, 641, 883
FaqI GGGAC 1 cut(s) 22
FatI CATG 4 cut(s) 301, 548, 637, 879
FbaI TGATCA 2 cut(s) 166, 634
Fnu4HI GCNGC 1 cut(s) 386
FokI GGATG 5 cut(s) 208, 383, 838, 892, 940
Fsp4HI GCNGC 1 cut(s) 386
FspBI CTAG 5 cut(s) 161, 338, 438, 752, 803
GluI GCNGC 1 cut(s) 386
GsaI CCCAGC 1 cut(s) 271
HaeIII GGCC 1 cut(s) 776
HapII CCGG 1 cut(s) 368
Hin1II CATG 4 cut(s) 305, 552, 641, 883
HinfI GANTC 4 cut(s) 10, 152, 359, 891
HpaII CCGG 1 cut(s) 368
HphI GGTGA 2 cut(s) 517, 829
Hpy166II GTNNAC 1 cut(s) 703
Hpy188I TCNGA 5 cut(s) 203, 261, 284, 350, 451
Hpy188III TCNNGA 2 cut(s) 210, 823
Hpy8I GTNNAC 1 cut(s) 703
HpyAV CCTTC 4 cut(s) 35, 61, 430, 569
HpyCH4V TGCA 4 cut(s) 470, 603, 612, 708
HpyF10VI GCNNNNNNNGC 2 cut(s) 391, 609
HpyF3I CTNAG 5 cut(s) 24, 226, 501, 737, 927
Hsp92II CATG 4 cut(s) 305, 552, 641, 883
Ksp22I TGATCA 2 cut(s) 166, 634
Kzo9I GATC 6 cut(s) 31, 47, 166, 446, 634, 819
LmnI GCTCC 1 cut(s) 483
Lsp1109I GCAGC 1 cut(s) 397
LweI GCATC 3 cut(s) 495, 612, 914
MaeI CTAG 5 cut(s) 161, 338, 438, 752, 803
MalI GATC 6 cut(s) 33, 49, 168, 448, 636, 821
MboI GATC 6 cut(s) 31, 47, 166, 446, 634, 819
MboII GAAGA 6 cut(s) 161, 297, 520, 550, 582, 887
MluCI AATT 9 cut(s) 92, 114, 179, 289, 404, 456, 711, 810, 853
MlyI GAGTC 3 cut(s) 4, 368, 900
MnlI CCTC 7 cut(s) 132, 331, 616, 685, 759, 854, 864
MseI TTAA 3 cut(s) 293, 434, 966
MslI CAYNNNNRTG 1 cut(s) 910
MspI CCGG 1 cut(s) 368
MspR9I CCNGG 1 cut(s) 576
MvaI CCWGG 1 cut(s) 576
MwoI GCNNNNNNNGC 2 cut(s) 391, 609
NdeII GATC 6 cut(s) 31, 47, 166, 446, 634, 819
NheI GCTAGC 1 cut(s) 802
NlaIII CATG 4 cut(s) 305, 552, 641, 883
NlaIV GGNNCC 1 cut(s) 495
NspI RCATGY 2 cut(s) 552, 883
PciI ACATGT 2 cut(s) 548, 879
PfeI GAWTC 1 cut(s) 152
PkrI GCNGC 1 cut(s) 387
PleI GAGTC 3 cut(s) 4, 367, 899
PpsI GAGTC 3 cut(s) 4, 367, 899
PscI ACATGT 2 cut(s) 548, 879
PsiI TTATAA 1 cut(s) 945
Psp6I CCWGG 1 cut(s) 574
PspFI CCCAGC 1 cut(s) 267
PspGI CCWGG 1 cut(s) 574
PspN4I GGNNCC 1 cut(s) 495
RseI CAYNNNNRTG 1 cut(s) 910
SaqAI TTAA 3 cut(s) 293, 434, 966
SatI GCNGC 1 cut(s) 386
Sau3AI GATC 6 cut(s) 31, 47, 166, 446, 634, 819
SchI GAGTC 3 cut(s) 4, 368, 900
ScrFI CCNGG 1 cut(s) 576
SfaNI GCATC 3 cut(s) 495, 612, 914
SmiMI CAYNNNNRTG 1 cut(s) 910
SmlI CTYRAG 1 cut(s) 389
SmoI CTYRAG 1 cut(s) 389
SpeI ACTAGT 1 cut(s) 437
Sse9I AATT 9 cut(s) 92, 114, 179, 289, 404, 456, 711, 810, 853
SspMI CTAG 5 cut(s) 161, 338, 438, 752, 803
StyD4I CCNGG 1 cut(s) 574
StyI CCWWGG 3 cut(s) 62, 100, 191
TasI AATT 9 cut(s) 92, 114, 179, 289, 404, 456, 711, 810, 853
TfiI GAWTC 1 cut(s) 152
Tru1I TTAA 3 cut(s) 293, 434, 966
Tru9I TTAA 3 cut(s) 293, 434, 966
TscAI CASTG 4 cut(s) 234, 431, 537, 602
TseI GCWGC 1 cut(s) 385
TspDTI ATGAA 1 cut(s) 387
TspRI CASTG 4 cut(s) 234, 431, 537, 602
XapI RAATTY 4 cut(s) 92, 179, 289, 404
XceI RCATGY 2 cut(s) 552, 883
XspI CTAG 5 cut(s) 161, 338, 438, 752, 803
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.