Rmu_sc0001301.1_g000012

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001301.1
OG0000951
Physical Location & Seq
Reverse (-)
37700 .. 38005
306 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001301.1_g000012.1.cds

Sequence Viewer

Length: 306 bp
atgggcctcccagtgaagcttgagagttcttccttgtgtttggtaccctcagattcacagcaaggtactccaccaccactggaatcacaaacatcctcatcgccaacgccctcgcgcagaggcagagccacccgaaaatgccaaatcggtacagtcgatgacaatgtccaggttaatctagaaaggtttttcaccctatcttgggtagactccgactttatcctcgaggccctgaggaaagaacggcaacaattcgccgaggaattacaacgcctcaagattcggattctaatgtttatgcggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

101

Amino Acids

11.53

Weight (kDa)

8.8

Isoelectric Point (pI)

61.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 224
Acc65I GGTACC 1 cut(s) 43
AccB1I GGYRCC 1 cut(s) 43
AccI GTMKAC 1 cut(s) 207
AccII CGCG 1 cut(s) 115
AciI CCGC 1 cut(s) 301
AfaI GTAC 3 cut(s) 45, 67, 151
AfiI CCNNNNNNNGG 2 cut(s) 201, 202
AjnI CCWGG 1 cut(s) 168
AluBI AGCT 1 cut(s) 19
AluI AGCT 1 cut(s) 19
Ama87I CYCGRG 1 cut(s) 224
AoxI GGCC 2 cut(s) 4, 228
Asp718I GGTACC 1 cut(s) 43
AspLEI GCGC 1 cut(s) 117
AspS9I GGNCC 2 cut(s) 4, 229
AsuHPI GGTGA 1 cut(s) 184
AvaI CYCGRG 1 cut(s) 224
AxyI CCTNAGG 1 cut(s) 233
BanI GGYRCC 1 cut(s) 43
BceAI ACGGC 1 cut(s) 260
BciT130I CCWGG 1 cut(s) 170
BfaI CTAG 1 cut(s) 179
Bme1390I CCNGG 1 cut(s) 170
BmeT110I CYCGRG 1 cut(s) 224
BmgT120I GGNCC 2 cut(s) 4, 229
BmiI GGNNCC 1 cut(s) 45
BmrFI CCNGG 1 cut(s) 170
BmrI ACTGGG 1 cut(s) 5
BmuI ACTGGG 1 cut(s) 5
BpuEI CTTGAG 2 cut(s) 41, 260
BsaJI CCNNGG 1 cut(s) 258
Bsc4I CCNNNNNNNGG 2 cut(s) 201, 202
Bse1I ACTGG 2 cut(s) 11, 84
Bse21I CCTNAGG 1 cut(s) 233
BseBI CCWGG 1 cut(s) 170
BseDI CCNNGG 1 cut(s) 258
BseGI GGATG 1 cut(s) 92
BseLI CCNNNNNNNGG 2 cut(s) 201, 202
BseMII CTCAG 2 cut(s) 63, 224
BseNI ACTGG 2 cut(s) 11, 84
Bsh1236I CGCG 1 cut(s) 115
BshFI GGCC 2 cut(s) 6, 230
BshNI GGYRCC 1 cut(s) 43
BsiHKCI CYCGRG 1 cut(s) 224
BslI CCNNNNNNNGG 2 cut(s) 201, 202
BsnI GGCC 2 cut(s) 6, 230
BsoBI CYCGRG 1 cut(s) 224
BspACI CCGC 1 cut(s) 301
BspANI GGCC 2 cut(s) 6, 230
BspCNI CTCAG 2 cut(s) 62, 225
BspFNI CGCG 1 cut(s) 115
BspLI GGNNCC 1 cut(s) 45
BspT107I GGYRCC 1 cut(s) 43
BsrI ACTGG 2 cut(s) 11, 84
BssECI CCNNGG 1 cut(s) 258
Bst2UI CCWGG 1 cut(s) 170
Bst4CI ACNGT 1 cut(s) 154
BstDEI CTNAG 2 cut(s) 49, 233
BstF5I GGATG 1 cut(s) 92
BstFNI CGCG 1 cut(s) 115
BstHHI GCGC 1 cut(s) 117
BstNI CCWGG 1 cut(s) 170
BstSCI CCNGG 1 cut(s) 168
BstUI CGCG 1 cut(s) 115
Bsu36I CCTNAGG 1 cut(s) 233
BsuRI GGCC 2 cut(s) 6, 230
BtgZI GCGATG 1 cut(s) 84
BtsCI GGATG 1 cut(s) 92
BtsIMutI CAGTG 2 cut(s) 18, 77
CfoI GCGC 1 cut(s) 117
Cfr13I GGNCC 2 cut(s) 4, 229
Csp6I GTAC 3 cut(s) 44, 66, 150
CviJI RGCY 4 cut(s) 6, 19, 128, 230
CviKI_1 RGCY 4 cut(s) 6, 19, 128, 230
CviQI GTAC 3 cut(s) 44, 66, 150
DdeI CTNAG 2 cut(s) 49, 233
Eco81I CCTNAGG 1 cut(s) 233
Eco88I CYCGRG 1 cut(s) 224
EcoO109I RGGNCCY 1 cut(s) 229
EcoRII CCWGG 1 cut(s) 168
FaiI YATR 1 cut(s) 299
FblI GTMKAC 1 cut(s) 207
FokI GGATG 1 cut(s) 79
FspBI CTAG 1 cut(s) 179
GlaI GCGC 1 cut(s) 116
HaeIII GGCC 2 cut(s) 6, 230
HhaI GCGC 1 cut(s) 117
Hin6I GCGC 1 cut(s) 115
HinP1I GCGC 1 cut(s) 115
HindIII AAGCTT 1 cut(s) 17
HinfI GANTC 5 cut(s) 53, 83, 209, 280, 286
HphI GGTGA 1 cut(s) 184
Hpy166II GTNNAC 1 cut(s) 208
Hpy188I TCNGA 3 cut(s) 52, 214, 285
Hpy188III TCNNGA 2 cut(s) 179, 277
Hpy8I GTNNAC 1 cut(s) 208
HpyCH4III ACNGT 1 cut(s) 154
HpyF3I CTNAG 2 cut(s) 49, 233
HspAI GCGC 1 cut(s) 115
KpnI GGTACC 1 cut(s) 47
LpnPI CCDG 5 cut(s) 24, 65, 155, 182, 245
MaeI CTAG 1 cut(s) 179
MboII GAAGA 1 cut(s) 21
MluCI AATT 2 cut(s) 251, 263
MlyI GAGTC 1 cut(s) 203
MmeI TCCRAC 1 cut(s) 237
MseI TTAA 1 cut(s) 174
MspR9I CCNGG 1 cut(s) 170
MvaI CCWGG 1 cut(s) 170
MvnI CGCG 1 cut(s) 115
NlaIV GGNNCC 1 cut(s) 45
NmeAIII GCCGAG 1 cut(s) 283
PaeR7I CTCGAG 1 cut(s) 224
PcsI WCGNNNNNNNCGW 1 cut(s) 153
PfeI GAWTC 4 cut(s) 53, 83, 280, 286
PflFI GACNNNGTC 1 cut(s) 164
PleI GAGTC 1 cut(s) 203
PpsI GAGTC 1 cut(s) 203
Psp6I CCWGG 1 cut(s) 168
PspGI CCWGG 1 cut(s) 168
PspN4I GGNNCC 1 cut(s) 45
PspPI GGNCC 2 cut(s) 4, 229
PspXI VCTCGAGB 1 cut(s) 224
PsyI GACNNNGTC 1 cut(s) 164
RsaI GTAC 3 cut(s) 45, 67, 151
RsaNI GTAC 3 cut(s) 44, 66, 150
SaqAI TTAA 1 cut(s) 174
Sau96I GGNCC 2 cut(s) 4, 229
SchI GAGTC 1 cut(s) 203
ScrFI CCNGG 1 cut(s) 170
SetI ASST 4 cut(s) 21, 67, 174, 188
Sfr274I CTCGAG 1 cut(s) 224
SlaI CTCGAG 1 cut(s) 224
SmlI CTYRAG 3 cut(s) 20, 224, 275
SmoI CTYRAG 3 cut(s) 20, 224, 275
Sse9I AATT 2 cut(s) 251, 263
SsiI CCGC 1 cut(s) 301
SspMI CTAG 1 cut(s) 179
StyD4I CCNGG 1 cut(s) 168
TaaI ACNGT 1 cut(s) 154
TaqI TCGA 2 cut(s) 156, 225
TasI AATT 2 cut(s) 251, 263
TfiI GAWTC 4 cut(s) 53, 83, 280, 286
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TscAI CASTG 2 cut(s) 18, 84
TspRI CASTG 2 cut(s) 18, 84
Tth111I GACNNNGTC 1 cut(s) 164
XbaI TCTAGA 1 cut(s) 178
XhoI CTCGAG 1 cut(s) 224
XmiI GTMKAC 1 cut(s) 207
XspI CTAG 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.