Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0039105.1

Orthogroup ID

OG0000951

Physical Location & Seq

Genomic Coordinates Forward (+)

363 .. 650

Gene Structure 288 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0039105.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 288 bp

atgtcttattctacatttggggagcaacatgatcacttggctactccacctccaccacccttagtatcgccgcaatccttatcgccgatttgtttccgattgccgcgcaaagtcgcctcaaaatccaaaatcggttctgtcgatgacatcgcagttaatctcaatagggttcttgccctatcttggctagactcggagtttgtgcttgaggctctgaggagagaatgccaagaatttgcagaggagttgcagtgccgcaaaattcgcactttaatgtctatgcggtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

95

Amino Acids

10.78

Weight (kDa)

7.75

Isoelectric Point (pI)

67.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000951)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g33461 FvH4_6g41810 FvH4_6g41910 FvH4_6g41910
malus_domestica	MD08G1211400.v1.1
rosa_laevigata	RLG00000001363 RLG00000002321 RLG00000002324 RLG00000002337 RLG00000002348 RLG00000002351 RLG00000002356 RLG00000015133 RLG00000015138 RLG00000021019 RLG00000023283
rosa_multiflora	Rmu_sc0001301.1_g000012 Rmu_sc0001539.1_g000006 Rmu_sc0039105.1_g000001
rosa_roxburghii	Rroxscaffold_3G00240210 Rroxscaffold_3G00240480 Rroxscaffold_4G00310990
rosa_rugosa	Rorug02G0463400 Rorug07G0177300 Rorug07G0290300 Rorug07G0290400 Rorug07G0290500 Rorug07G0290600
rosa_samantha	Rh1BG149400 Rh1DG181200 Rh2AG528900 Rh2BG283600 Rh2BG542800 Rh2BG542900 Rh2CG513200 Rh2DG280000 Rh2DG551800 Rh7AG275500 Rh7AG317300 Rh7AG320700 Rh7AG321400 Rh7AG324200 Rh7AG324800 Rh7AG325400 Rh7AG326300 Rh7AG326400 Rh7BG312800 Rh7BG316000 Rh7BG316100 Rh7BG316200 Rh7BG316800 Rh7BG342200 Rh7CG294300 Rh7CG334100 Rh7CG337500 Rh7CG337900 Rh7CG341600 Rh7CG342500 Rh7CG343300 Rh7CG343500 Rh7CG358900 Rh7DG282400
rosa_wichuraiana	Rw2G043730 Rw7G028380

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	106
AciI	CCGC	4 cut(s)	71, 104, 256, 283
AcsI	RAATTY	2 cut(s)	233, 261
AfiI	CCNNNNNNNGG	1 cut(s)	183
ApoI	RAATTY	2 cut(s)	233, 261
ArsI	GACNNNNNNTTYG	2 cut(s)	182, 214
AspLEI	GCGC	1 cut(s)	108
BclI	TGATCA	1 cut(s)	31
BfaI	CTAG	1 cut(s)	188
BisI	GCNGC	3 cut(s)	71, 104, 256
BlsI	GCNGC	3 cut(s)	72, 105, 257
BpuEI	CTTGAG	1 cut(s)	227
BsaXI	ACNNNNNCTCC	4 cut(s)	34, 64, 236, 266
Bsc4I	CCNNNNNNNGG	1 cut(s)	183
BseLI	CCNNNNNNNGG	1 cut(s)	183
BseMII	CTCAG	1 cut(s)	206
BseRI	GAGGAG	2 cut(s)	232, 257
Bsh1236I	CGCG	1 cut(s)	106
BslI	CCNNNNNNNGG	1 cut(s)	183
BsmI	GAATGC	1 cut(s)	230
Bsp143I	GATC	1 cut(s)	31
BspACI	CCGC	4 cut(s)	71, 104, 256, 283
BspCNI	CTCAG	1 cut(s)	207
BspFNI	CGCG	1 cut(s)	106
BssMI	GATC	1 cut(s)	31
BstDEI	CTNAG	2 cut(s)	61, 215
BstFNI	CGCG	1 cut(s)	106
BstHHI	GCGC	1 cut(s)	108
BstKTI	GATC	1 cut(s)	34
BstMBI	GATC	1 cut(s)	31
BstMWI	GCNNNNNNNGC	1 cut(s)	264
BstUI	CGCG	1 cut(s)	106
BtgZI	GCGATG	1 cut(s)	133
BtsI	GCAGTG	1 cut(s)	257
BtsIMutI	CAGTG	1 cut(s)	257
CfoI	GCGC	1 cut(s)	108
CviAII	CATG	1 cut(s)	29
CviJI	RGCY	3 cut(s)	41, 187, 212
CviKI_1	RGCY	3 cut(s)	41, 187, 212
DdeI	CTNAG	2 cut(s)	61, 215
DpnI	GATC	1 cut(s)	33
DpnII	GATC	1 cut(s)	31
FaeI	CATG	1 cut(s)	32
FaiI	YATR	2 cut(s)	30, 281
FatI	CATG	1 cut(s)	28
FbaI	TGATCA	1 cut(s)	31
Fnu4HI	GCNGC	3 cut(s)	71, 104, 256
Fsp4HI	GCNGC	3 cut(s)	71, 104, 256
FspBI	CTAG	1 cut(s)	188
GlaI	GCGC	1 cut(s)	107
GluI	GCNGC	3 cut(s)	71, 104, 256
HhaI	GCGC	1 cut(s)	108
Hin1II	CATG	1 cut(s)	32
Hin6I	GCGC	1 cut(s)	106
HinP1I	GCGC	1 cut(s)	106
HinfI	GANTC	1 cut(s)	191
Hpy188I	TCNGA	3 cut(s)	98, 196, 216
HpyCH4V	TGCA	2 cut(s)	239, 250
HpyF10VI	GCNNNNNNNGC	1 cut(s)	264
HpyF3I	CTNAG	2 cut(s)	61, 215
Hsp92II	CATG	1 cut(s)	32
HspAI	GCGC	1 cut(s)	106
Ksp22I	TGATCA	1 cut(s)	31
Kzo9I	GATC	1 cut(s)	31
LmnI	GCTCC	1 cut(s)	22
MaeI	CTAG	1 cut(s)	188
MalI	GATC	1 cut(s)	33
MboI	GATC	1 cut(s)	31
MluCI	AATT	2 cut(s)	233, 261
MlyI	GAGTC	1 cut(s)	185
MnlI	CCTC	5 cut(s)	60, 127, 202, 210, 235
MseI	TTAA	2 cut(s)	156, 272
MslI	CAYNNNNRTG	1 cut(s)	272
Mva1269I	GAATGC	1 cut(s)	230
MvnI	CGCG	1 cut(s)	106
MwoI	GCNNNNNNNGC	1 cut(s)	264
NdeII	GATC	1 cut(s)	31
NlaIII	CATG	1 cut(s)	32
PcsI	WCGNNNNNNNCGW	1 cut(s)	138
PctI	GAATGC	1 cut(s)	230
PkrI	GCNGC	3 cut(s)	72, 105, 257
PleI	GAGTC	1 cut(s)	185
PpsI	GAGTC	1 cut(s)	185
RseI	CAYNNNNRTG	1 cut(s)	272
SaqAI	TTAA	2 cut(s)	156, 272
SatI	GCNGC	3 cut(s)	71, 104, 256
Sau3AI	GATC	1 cut(s)	31
SchI	GAGTC	1 cut(s)	185
SetI	ASST	1 cut(s)	52
SgeI	CNNG	9 cut(s)	41, 49, 117, 185, 195, 200, 205, 218, 242
SmiMI	CAYNNNNRTG	1 cut(s)	272
SmlI	CTYRAG	1 cut(s)	206
SmoI	CTYRAG	1 cut(s)	206
Sse9I	AATT	2 cut(s)	233, 261
SsiI	CCGC	4 cut(s)	71, 104, 256, 283
SspMI	CTAG	1 cut(s)	188
TaqI	TCGA	1 cut(s)	141
TasI	AATT	2 cut(s)	233, 261
TauI	GCSGC	3 cut(s)	73, 106, 258
Tru1I	TTAA	2 cut(s)	156, 272
Tru9I	TTAA	2 cut(s)	156, 272
TscAI	CASTG	1 cut(s)	257
TspRI	CASTG	1 cut(s)	257
XapI	RAATTY	2 cut(s)	233, 261
XspI	CTAG	1 cut(s)	188

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.