Rmu_sc0005195.1_g000001

UDP-Glycosyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005195.1
OG0000097
Physical Location & Seq
Forward (+)
478 .. 2054
1577 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005195.1_g000001.1.cds

Sequence Viewer

Length: 1353 bp
atgctcaaactagcaaaactcctccaccacagaggtcttcatataacctttgtcaacacagtgttcaaccataaacgctttcttcaatctctaggacctaactcccttgatggcttgcctgattttcggttcgaaaccattccagatggccttccaagttcagatgaatgtgtgaatcaagacgtctatttgctttgtggtgctgtcaggaaaaatttcttagctccgtttcaagacctcctcaagaaactcaatgaaactgcaattacttcccacagtactaatcctccggtgactcggataatagcagacggttggaatccctttgtcttcagagcagcagaaacaaatcgaatccctgttacactcttctttcctgttgctgcaagcagcttcatgggatttgcacaatatcccgctttgatggaaaaaggattagcaccactcaaagacgagagctgtttcacaaacgggtatttggacaaggtcatagattggattccaggactgaaagatatccgattaagggatctcccgaccaactttcaagtcacaaatcctgatgacggcttctggaaccactgcttggaagcaattgaaggagttcaaaaagctgaagctgttgttcttcatacttatgatgcattggagcatcatgttttggaatctctctcgtctacgcttcatccacatgttcatgccattggccctctccaattactccttaatcagataccagaacaccctttgaaccctatgggttacagtctatggaaagaagaaaccgagtgcctccaatggctcaactccaaagtgccaaattcagttgtttatgtgaacttcggcagtttaacgatcatgacatcgaacaatcttgtagagtttgcttggggacttgcaaataccaagcttcccttcttttgggtaattagacctgattcagttgctggtgaatcggctattttgccaccagagtttgtggctgaaaccaaacaaagaggtctaatagcaagttggtgcccacaagagcaagtgcttaaccacccagcagttggagggtttttaacacacagcggttggaattcaatgattgagagtgtgactgcaggagtgcctatgttgtgctggccagtctgctcagaccaacaaacaaatacctggtctgcttgcaatgaatggggaattggcattgagatcatcagtaatgaagtgaagagagacgaaatagagaagcttgttaaacaggtgaggtgcctatgttgtgctggccagtctgctcagaccaacaaacaaatacctggtctgcgtgcaatgaatggggaattggcattgagatcatcagtaatgaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
UDPGT

Protein Analysis

450

Amino Acids

50.21

Weight (kDa)

5.84

Isoelectric Point (pI)

38.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000097)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g17511 FvH4_3g17550 FvH4_3g17550 FvH4_3g17550 FvH4_6g39790 FvH4_6g39792 FvH4_6g39810 FvH4_6g39810 FvH4_6g39810 FvH4_6g39811 FvH4_6g39813 FvH4_6g39814 FvH4_6g39814 FvH4_6g39840 FvH4_6g39842 FvH4_6g39843 FvH4_6g39845 FvH4_6g39850 FvH4_6g39870 FvH4_6g39871 FvH4_6g39871 FvH4_6g39871 FvH4_6g39872
malus_domestica MD00G1121500.v1.1 MD09G1135900.v1.1 MD09G1136000.v1.1 MD09G1136200.v1.1 MD09G1142300.v1.1 MD09G1142500.v1.1 MD09G1142800.v1.1 MD11G1215800.v1.1 MD13G1225900.v1.1 MD13G1226000.v1.1 MD16G1231000.v1.1 MD16G1231100.v1.1 MD17G1124400.v1.1 MD17G1124800.v1.1 MD17G1124900.v1.1 MD17G1125000.v1.1 MD17G1125400.v1.1 MD17G1125700.v1.1 MD17G1125800.v1.1 MD17G1125900.v1.1 MD17G1126300.v1.1 MD17G1126400.v1.1 MD17G1126700.v1.1 MD17G1126800.v1.1 MD17G1126900.v1.1
prunus_persica Prupe.1G053100_v2.0.a1 Prupe.1G053200_v2.0.a1 Prupe.1G053300_v2.0.a1 Prupe.1G053400_v2.0.a1 Prupe.1G053500_v2.0.a1 Prupe.1G055800_v2.0.a1 Prupe.3G188400_v2.0.a1 Prupe.3G188500_v2.0.a1 Prupe.3G188600_v2.0.a1 Prupe.3G188700_v2.0.a1 Prupe.3G189100_v2.0.a1 Prupe.3G189300_v2.0.a1 Prupe.3G189500_v2.0.a1 Prupe.3G189600_v2.0.a1 Prupe.3G189700_v2.0.a1 Prupe.3G190100_v2.0.a1 Prupe.3G190300_v2.0.a1 Prupe.3G190400_v2.0.a1 Prupe.3G190500_v2.0.a1 Prupe.3G190600_v2.0.a1 Prupe.3G190800_v2.0.a1 Prupe.4G236600_v2.0.a1 Prupe.4G236700_v2.0.a1 Prupe.4G236800_v2.0.a1 Prupe.4G237000_v2.0.a1
pyrus_communis pycom09g05690 pycom09g05700 pycom09g05710 pycom09g05720 pycom09g05730 pycom09g05740 pycom09g05750 pycom09g05760 pycom09g05770 pycom09g06250 pycom09g06260 pycom09g06280 pycom13g19910 pycom16g19350 pycom17g11590 pycom17g11650 pycom17g11670 pycom17g11680 pycom17g11690 pycom17g11760 pycom17g11780 pycom17g11800 pycom17g11820 pycom17g11830 pycom17g11860 pycom17g11870
rosa_chinensis RchiOBHm_Chr1g0340871 RchiOBHm_Chr2g0124501 RchiOBHm_Chr2g0149801 RchiOBHm_Chr2g0149811 RchiOBHm_Chr2g0153911 RchiOBHm_Chr2g0153971 RchiOBHm_Chr2g0153981 RchiOBHm_Chr2g0154001 RchiOBHm_Chr2g0154021 RchiOBHm_Chr2g0154031 RchiOBHm_Chr2g0154041 RchiOBHm_Chr2g0154061 RchiOBHm_Chr2g0154071 RchiOBHm_Chr2g0154151 RchiOBHm_Chr2g0154191 RchiOBHm_Chr2g0154221 RchiOBHm_Chr2g0154301 RchiOBHm_Chr2g0154321 RchiOBHm_Chr2g0154331 RchiOBHm_Chr2g0154341 RchiOBHm_Chr2g0154351 RchiOBHm_Chr2g0154371 RchiOBHm_Chr5g0029061 RchiOBHm_Chr5g0029111 RchiOBHm_Chr5g0029131 RchiOBHm_Chr5g0029151 RchiOBHm_Chr5g0029271 RchiOBHm_Chr5g0038461 RchiOBHm_Chr5g0038821 RchiOBHm_Chr5g0059331 RchiOBHm_Chr7g0211221
rosa_laevigata RLG00000003018 RLG00000009631 RLG00000018804 RLG00000019613 RLG00000019617 RLG00000020446 RLG00000020447 RLG00000020738 RLG00000020742 RLG00000020743 RLG00000020746 RLG00000020752 RLG00000020754 RLG00000020755 RLG00000020756 RLG00000020759 RLG00000020761 RLG00000020762 RLG00000020765 RLG00000020770 RLG00000020771 RLG00000020772 RLG00000020773 RLG00000020774 RLG00000033136 RLG00000033146 RLG00000033148 RLG00000033870 RLG00000033876
rosa_multiflora Rmu_co8137600.1_g000001 Rmu_co8174218.1_g000001 Rmu_co8313823.1_g000001 Rmu_sc0000533.1_g000092 Rmu_sc0000857.1_g000006 Rmu_sc0000857.1_g000021 Rmu_sc0000857.1_g000028 Rmu_sc0001017.1_g000018 Rmu_sc0002214.1_g000001 Rmu_sc0002214.1_g000010 Rmu_sc0002474.1_g000003 Rmu_sc0002474.1_g000011 Rmu_sc0002474.1_g000015 Rmu_sc0003808.1_g000003 Rmu_sc0005195.1_g000001 Rmu_sc0005836.1_g000010 Rmu_sc0006451.1_g000005 Rmu_sc0007313.1_g000006 Rmu_sc0007324.1_g000011 Rmu_sc0012347.1_g000008 Rmu_sc0012977.1_g000001 Rmu_sc0014312.1_g000004 Rmu_sc0014312.1_g000005 Rmu_sc0015490.1_g000001 Rmu_sc0018451.1_g000003 Rmu_sc0022116.1_g000004 Rmu_sc0022116.1_g000005 Rmu_sc0025399.1_g000001 Rmu_sc0031326.1_g000001 Rmu_sc0031654.1_g000002 Rmu_ssc0000308.1_g000037
rosa_roxburghii Rroxscaffold_1G00042160 Rroxscaffold_1G00042210 Rroxscaffold_1G00050730 Rroxscaffold_1G00050780 Rroxscaffold_2G00094400 Rroxscaffold_2G00094410 Rroxscaffold_2G00094420 Rroxscaffold_2G00094440 Rroxscaffold_2G00094470 Rroxscaffold_2G00094480 Rroxscaffold_2G00094490 Rroxscaffold_2G00094510 Rroxscaffold_2G00094520 Rroxscaffold_2G00094530 Rroxscaffold_2G00094540 Rroxscaffold_2G00094550 Rroxscaffold_2G00094560 Rroxscaffold_2G00094590 Rroxscaffold_2G00094660 Rroxscaffold_2G00097680 Rroxscaffold_2G00121030 Rroxscaffold_2G00121040 Rroxscaffold_5G00340200
rosa_rugosa Rorug02G0416600 Rorug02G0416700 Rorug02G0443200 Rorug02G0443400 Rorug02G0443500 Rorug02G0443600 Rorug02G0443700 Rorug02G0443900 Rorug02G0444000 Rorug03G0256900 Rorug03G0257000 Rorug05G0112400 Rorug05G0112600 Rorug05G0174300 Rorug07G0124600
rosa_samantha Rh2BG318500 Rh2BG487300 Rh2BG487500 Rh2BG516900 Rh2BG517000 Rh2BG518000 Rh2BG518100 Rh2BG518300 Rh2BG518400 Rh2BG518500 Rh2BG519400 Rh2BG519500 Rh2BG519600 Rh2BG519700 Rh5BG203100 Rh5BG203500 Rh5BG265800 Rh5BG398100 Rh7CG273600
rosa_wichuraiana Rw2G038790 Rw2G038800 Rw2G041610 Rw2G041620 Rw2G041640 Rw2G041660 Rw2G041670 Rw2G041680 Rw2G041690 Rw2G041700 Rw2G041720 Rw2G041730 Rw2G041740 Rw2G041750 Rw5G018550 Rw5G018570 Rw5G018590 Rw5G018610 Rw5G024410

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 186
AccB1I GGYRCC 2 cut(s) 1017, 1251
AccB7I CCANNNNNTGG 2 cut(s) 586, 1052
AccI GTMKAC 1 cut(s) 677
AciI CCGC 2 cut(s) 417, 1074
AclWI GGATC 1 cut(s) 537
AcoI YGGCCR 2 cut(s) 1127, 1267
AcsI RAATTY 3 cut(s) 214, 820, 1081
AcuI CTGAAG 2 cut(s) 316, 636
AcyI GRCGYC 1 cut(s) 183
AfaI GTAC 1 cut(s) 280
AfiI CCNNNNNNNGG 5 cut(s) 526, 566, 586, 921, 1052
AflIII ACRYGT 1 cut(s) 691
AgsI TTSAA 8 cut(s) 67, 86, 233, 548, 599, 608, 751, 1086
AjnI CCWGG 3 cut(s) 502, 1157, 1297
AjuI GAANNNNNNNTTGG 8 cut(s) 569, 601, 899, 931, 1167, 1199, 1307, 1339
AluBI AGCT 7 cut(s) 224, 393, 459, 614, 620, 910, 1234
AluI AGCT 7 cut(s) 224, 393, 459, 614, 620, 910, 1234
Alw26I GTCTC 1 cut(s) 1212
AlwI GGATC 1 cut(s) 537
AlwNI CAGNNNCTG 1 cut(s) 947
AoxI GGCC 4 cut(s) 148, 706, 1127, 1267
ApeKI GCWGC 3 cut(s) 338, 383, 390
ApoI RAATTY 3 cut(s) 214, 820, 1081
ArsI GACNNNNNNTTYG 4 cut(s) 1145, 1177, 1285, 1317
Asp700I GAANNNNTTC 3 cut(s) 138, 215, 603
AspS9I GGNCC 2 cut(s) 95, 707
AsuHPI GGTGA 3 cut(s) 304, 962, 1258
AsuII TTCGAA 1 cut(s) 132
AvaII GGWCC 1 cut(s) 95
BaeGI GKGCMC 1 cut(s) 1022
BalI TGGCCA 2 cut(s) 1129, 1269
BanI GGYRCC 2 cut(s) 1017, 1251
BbsI GAAGAC 2 cut(s) 29, 322
BbvI GCAGC 3 cut(s) 350, 370, 402
BccI CCATC 3 cut(s) 104, 140, 418
BceAI ACGGC 1 cut(s) 583
BciT130I CCWGG 3 cut(s) 504, 1159, 1299
BcoDI GTCTC 1 cut(s) 1212
BfaI CTAG 2 cut(s) 11, 92
BfmI CTRYAG 1 cut(s) 1104
BisI GCNGC 3 cut(s) 339, 384, 391
BlsI GCNGC 3 cut(s) 340, 385, 392
BmcAI AGTACT 1 cut(s) 280
Bme1390I CCNGG 3 cut(s) 504, 1159, 1299
Bme18I GGWCC 1 cut(s) 95
BmgT120I GGNCC 2 cut(s) 95, 707
BmiI GGNNCC 3 cut(s) 578, 1019, 1253
BmrFI CCNGG 3 cut(s) 504, 1159, 1299
BmsI GCATC 2 cut(s) 631, 661
BpiI GAAGAC 2 cut(s) 29, 322
Bpu14I TTCGAA 1 cut(s) 132
BpuEI CTTGAG 1 cut(s) 227
BsaHI GRCGYC 1 cut(s) 183
BsaWI WCCGGW 1 cut(s) 289
BsaXI ACNNNNNCTCC 2 cut(s) 271, 301
Bsc4I CCNNNNNNNGG 5 cut(s) 526, 566, 586, 921, 1052
Bse1I ACTGG 2 cut(s) 1130, 1270
Bse3DI GCAATG 2 cut(s) 1177, 1317
BseBI CCWGG 3 cut(s) 504, 1159, 1299
BseGI GGATG 1 cut(s) 685
BseLI CCNNNNNNNGG 5 cut(s) 526, 566, 586, 921, 1052
BseMI GCAATG 2 cut(s) 1177, 1317
BseMII CTCAG 2 cut(s) 1152, 1292
BseNI ACTGG 2 cut(s) 1130, 1270
BseRI GAGGAG 2 cut(s) 11, 230
BseSI GKGCMC 1 cut(s) 1022
BseXI GCAGC 3 cut(s) 350, 370, 402
BseYI CCCAGC 1 cut(s) 1045
BshFI GGCC 4 cut(s) 150, 708, 1129, 1269
BshNI GGYRCC 2 cut(s) 1017, 1251
BsiSI CCGG 1 cut(s) 290
BslFI GGGAC 1 cut(s) 906
BslI CCNNNNNNNGG 5 cut(s) 526, 566, 586, 921, 1052
BsmAI GTCTC 1 cut(s) 1212
BsmBI CGTCTC 1 cut(s) 1212
BsmFI GGGAC 1 cut(s) 906
BsnI GGCC 4 cut(s) 150, 708, 1129, 1269
Bsp119I TTCGAA 1 cut(s) 132
Bsp1286I GDGCHC 1 cut(s) 1022
Bsp143I GATC 4 cut(s) 529, 855, 1194, 1334
BspACI CCGC 2 cut(s) 417, 1074
BspANI GGCC 4 cut(s) 150, 708, 1129, 1269
BspCNI CTCAG 2 cut(s) 1151, 1291
BspHI TCATGA 1 cut(s) 858
BspLI GGNNCC 3 cut(s) 578, 1019, 1253
BspMAI CTGCAG 1 cut(s) 1108
BspPI GGATC 1 cut(s) 537
BspT104I TTCGAA 1 cut(s) 132
BspT107I GGYRCC 2 cut(s) 1017, 1251
BsrDI GCAATG 2 cut(s) 1177, 1317
BsrI ACTGG 2 cut(s) 1130, 1270
BssMI GATC 4 cut(s) 529, 855, 1194, 1334
BssNI GRCGYC 1 cut(s) 183
Bst2UI CCWGG 3 cut(s) 504, 1159, 1299
Bst4CI ACNGT 4 cut(s) 61, 278, 314, 767
Bst6I CTCTTC 2 cut(s) 374, 1208
BstACI GRCGYC 1 cut(s) 183
BstBI TTCGAA 1 cut(s) 132
BstC8I GCNNGC 6 cut(s) 116, 388, 1127, 1168, 1267, 1308
BstDEI CTNAG 3 cut(s) 220, 1138, 1278
BstF5I GGATG 1 cut(s) 685
BstKTI GATC 4 cut(s) 532, 858, 1197, 1337
BstMAI GTCTC 1 cut(s) 1212
BstMBI GATC 4 cut(s) 529, 855, 1194, 1334
BstNI CCWGG 3 cut(s) 504, 1159, 1299
BstNSI RCATGY 1 cut(s) 695
BstSCI CCNGG 3 cut(s) 502, 1157, 1297
BstSFI CTRYAG 1 cut(s) 1104
BstSLI GKGCMC 1 cut(s) 1022
BstV1I GCAGC 3 cut(s) 350, 370, 402
BstV2I GAAGAC 2 cut(s) 29, 322
BstX2I RGATCY 1 cut(s) 529
BstYI RGATCY 1 cut(s) 529
BsuRI GGCC 4 cut(s) 150, 708, 1129, 1269
BtsCI GGATG 1 cut(s) 685
BtsI GCAGTG 1 cut(s) 580
BtsIMutI CAGTG 2 cut(s) 66, 580
Cac8I GCNNGC 6 cut(s) 116, 388, 1127, 1168, 1267, 1308
CaiI CAGNNNCTG 1 cut(s) 947
CciI TCATGA 1 cut(s) 858
Cfr13I GGNCC 2 cut(s) 95, 707
CsiI ACCWGGT 2 cut(s) 1157, 1297
Csp6I GTAC 1 cut(s) 279
CviAII CATG 5 cut(s) 397, 656, 692, 698, 859
CviQI GTAC 1 cut(s) 279
DdeI CTNAG 3 cut(s) 220, 1138, 1278
DpnI GATC 4 cut(s) 531, 857, 1196, 1336
DpnII GATC 4 cut(s) 529, 855, 1194, 1334
EaeI YGGCCR 2 cut(s) 1127, 1267
Eam1104I CTCTTC 2 cut(s) 374, 1208
EarI CTCTTC 2 cut(s) 374, 1208
Eco32I GATATC 1 cut(s) 517
Eco47I GGWCC 1 cut(s) 95
Eco57I CTGAAG 2 cut(s) 316, 636
EcoO109I RGGNCCY 1 cut(s) 95
EcoRI GAATTC 1 cut(s) 1081
EcoRII CCWGG 3 cut(s) 502, 1157, 1297
EcoRV GATATC 1 cut(s) 517
EcoT22I ATGCAT 1 cut(s) 646
Esp3I CGTCTC 1 cut(s) 1212
FaeI CATG 5 cut(s) 400, 659, 695, 701, 862
FalI AAGNNNNNCTT 2 cut(s) 899, 931
FaqI GGGAC 1 cut(s) 906
FatI CATG 5 cut(s) 396, 655, 691, 697, 858
FauI CCCGC 1 cut(s) 424
FblI GTMKAC 1 cut(s) 677
Fnu4HI GCNGC 3 cut(s) 339, 384, 391
FokI GGATG 1 cut(s) 672
Fsp4HI GCNGC 3 cut(s) 339, 384, 391
FspBI CTAG 2 cut(s) 11, 92
GluI GCNGC 3 cut(s) 339, 384, 391
GsaI CCCAGC 1 cut(s) 1049
HaeIII GGCC 4 cut(s) 150, 708, 1129, 1269
HapII CCGG 1 cut(s) 290
Hin1I GRCGYC 1 cut(s) 183
Hin1II CATG 5 cut(s) 400, 659, 695, 701, 862
HincII GTYRAC 1 cut(s) 55
HindII GTYRAC 1 cut(s) 55
HindIII AAGCTT 2 cut(s) 908, 1232
HinfI GANTC 8 cut(s) 175, 295, 319, 354, 499, 665, 938, 953
HpaII CCGG 1 cut(s) 290
HphI GGTGA 3 cut(s) 304, 962, 1258
Hpy166II GTNNAC 3 cut(s) 55, 678, 838
Hpy188I TCNGA 7 cut(s) 163, 300, 335, 521, 732, 1141, 1281
Hpy188III TCNNGA 9 cut(s) 143, 179, 208, 233, 244, 535, 560, 574, 859
Hpy8I GTNNAC 3 cut(s) 55, 678, 838
HpyAV CCTTC 3 cut(s) 161, 593, 925
HpyCH4III ACNGT 4 cut(s) 61, 278, 314, 767
HpyCH4IV ACGT 1 cut(s) 183
HpyCH4V TGCA 8 cut(s) 263, 386, 407, 644, 899, 1106, 1170, 1310
HpyF3I CTNAG 3 cut(s) 220, 1138, 1278
HpySE526I ACGT 1 cut(s) 183
Hsp92I GRCGYC 1 cut(s) 183
Hsp92II CATG 5 cut(s) 400, 659, 695, 701, 862
Kzo9I GATC 4 cut(s) 529, 855, 1194, 1334
LmnI GCTCC 2 cut(s) 229, 649
Lsp1109I GCAGC 3 cut(s) 350, 370, 402
LweI GCATC 2 cut(s) 631, 661
MabI ACCWGGT 2 cut(s) 1157, 1297
MaeI CTAG 2 cut(s) 11, 92
MaeII ACGT 1 cut(s) 183
MaeIII GTNAC 5 cut(s) 292, 361, 550, 761, 1099
MalI GATC 4 cut(s) 531, 857, 1196, 1336
MboI GATC 4 cut(s) 529, 855, 1194, 1334
MboII GAAGA 7 cut(s) 29, 74, 322, 361, 620, 791, 1225
MfeI CAATTG 1 cut(s) 594
MflI RGATCY 1 cut(s) 529
MhlI GDGCHC 1 cut(s) 1022
MlsI TGGCCA 2 cut(s) 1129, 1269
MluCI AATT 9 cut(s) 214, 264, 594, 716, 820, 927, 1081, 1182, 1322
MluNI TGGCCA 2 cut(s) 1129, 1269
MlyI GAGTC 1 cut(s) 289
MmeI TCCRAC 3 cut(s) 296, 1033, 1058
Mox20I TGGCCA 2 cut(s) 1129, 1269
Mph1103I ATGCAT 1 cut(s) 646
MroXI GAANNNNTTC 3 cut(s) 138, 215, 603
MscI TGGCCA 2 cut(s) 1129, 1269
MseI TTAA 6 cut(s) 524, 726, 851, 1038, 1064, 1239
MslI CAYNNNNRTG 3 cut(s) 636, 690, 696
Msp20I TGGCCA 2 cut(s) 1129, 1269
MspA1I CMGCKG 1 cut(s) 1074
MspI CCGG 1 cut(s) 290
MspR9I CCNGG 3 cut(s) 504, 1159, 1299
MunI CAATTG 1 cut(s) 594
MvaI CCWGG 3 cut(s) 504, 1159, 1299
NdeII GATC 4 cut(s) 529, 855, 1194, 1334
NlaIII CATG 5 cut(s) 400, 659, 695, 701, 862
NlaIV GGNNCC 3 cut(s) 578, 1019, 1253
NmuCI GTSAC 3 cut(s) 292, 550, 1099
NsiI ATGCAT 1 cut(s) 646
NspI RCATGY 1 cut(s) 695
NspV TTCGAA 1 cut(s) 132
PagI TCATGA 1 cut(s) 858
PciI ACATGT 1 cut(s) 691
PdmI GAANNNNTTC 3 cut(s) 138, 215, 603
PfeI GAWTC 7 cut(s) 175, 319, 354, 499, 665, 938, 953
PflFI GACNNNGTC 1 cut(s) 485
PflMI CCANNNNNTGG 2 cut(s) 586, 1052
PfoI TCCNGGA 1 cut(s) 502
PkrI GCNGC 3 cut(s) 340, 385, 392
PleI GAGTC 1 cut(s) 289
PpsI GAGTC 1 cut(s) 289
PpuMI RGGWCCY 1 cut(s) 95
PscI ACATGT 1 cut(s) 691
Psp5II RGGWCCY 1 cut(s) 95
Psp6I CCWGG 3 cut(s) 502, 1157, 1297
PspFI CCCAGC 1 cut(s) 1045
PspGI CCWGG 3 cut(s) 502, 1157, 1297
PspN4I GGNNCC 3 cut(s) 578, 1019, 1253
PspPI GGNCC 2 cut(s) 95, 707
PspPPI RGGWCCY 1 cut(s) 95
PstI CTGCAG 1 cut(s) 1108
PstNI CAGNNNCTG 1 cut(s) 947
PsuI RGATCY 1 cut(s) 529
PsyI GACNNNGTC 1 cut(s) 485
RsaI GTAC 1 cut(s) 280
RsaNI GTAC 1 cut(s) 279
RseI CAYNNNNRTG 3 cut(s) 636, 690, 696
SaqAI TTAA 6 cut(s) 524, 726, 851, 1038, 1064, 1239
SatI GCNGC 3 cut(s) 339, 384, 391
Sau3AI GATC 4 cut(s) 529, 855, 1194, 1334
Sau96I GGNCC 2 cut(s) 95, 707
ScaI AGTACT 1 cut(s) 280
SchI GAGTC 1 cut(s) 289
ScrFI CCNGG 3 cut(s) 504, 1159, 1299
SduI GDGCHC 1 cut(s) 1022
SexAI ACCWGGT 2 cut(s) 1157, 1297
SfaNI GCATC 2 cut(s) 631, 661
SfcI CTRYAG 1 cut(s) 1104
SfuI TTCGAA 1 cut(s) 132
SinI GGWCC 1 cut(s) 95
SmiMI CAYNNNNRTG 3 cut(s) 636, 690, 696
SmlI CTYRAG 1 cut(s) 242
SmoI CTYRAG 1 cut(s) 242
Sse9I AATT 9 cut(s) 214, 264, 594, 716, 820, 927, 1081, 1182, 1322
SsiI CCGC 2 cut(s) 417, 1074
SspMI CTAG 2 cut(s) 11, 92
StyD4I CCNGG 3 cut(s) 502, 1157, 1297
TaaI ACNGT 4 cut(s) 61, 278, 314, 767
TaiI ACGT 1 cut(s) 186
TaqI TCGA 3 cut(s) 132, 352, 866
TasI AATT 9 cut(s) 214, 264, 594, 716, 820, 927, 1081, 1182, 1322
TatI WGTACW 1 cut(s) 278
TfiI GAWTC 7 cut(s) 175, 319, 354, 499, 665, 938, 953
Tru1I TTAA 6 cut(s) 524, 726, 851, 1038, 1064, 1239
Tru9I TTAA 6 cut(s) 524, 726, 851, 1038, 1064, 1239
TscAI CASTG 2 cut(s) 66, 587
TseFI GTSAC 3 cut(s) 292, 550, 1099
TseI GCWGC 3 cut(s) 338, 383, 390
Tsp45I GTSAC 3 cut(s) 292, 550, 1099
TspGWI ACGGA 1 cut(s) 216
TspRI CASTG 2 cut(s) 66, 587
Tth111I GACNNNGTC 1 cut(s) 485
Van91I CCANNNNNTGG 2 cut(s) 586, 1052
VpaK11BI GGWCC 1 cut(s) 95
XapI RAATTY 3 cut(s) 214, 820, 1081
XceI RCATGY 1 cut(s) 695
XcmI CCANNNNNNNNNTGG 1 cut(s) 1049
XmiI GTMKAC 1 cut(s) 677
XmnI GAANNNNTTC 3 cut(s) 138, 215, 603
XspI CTAG 2 cut(s) 11, 92
ZraI GACGTC 1 cut(s) 184
ZrmI AGTACT 1 cut(s) 280
Zsp2I ATGCAT 1 cut(s) 646
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.