Rmu_sc0012977.1_g000001

UDP-Glycosyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012977.1
OG0000097
Physical Location & Seq
Forward (+)
1868 .. 2371
504 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012977.1_g000001.1.cds

Sequence Viewer

Length: 504 bp
atggcttctaagaagcctcatgctgtgtgtattccagctccatctctaggccacataaaggtagtgcttaaactagcaaaactactacaccataaaggctttcatataacctttgtcaacacagagtcctttcacaagcgctatcttaaatctctaagctccaactccttagacggtctccccgattttcagtttgaaaccatttcagatggcctaccagattctgatgttgatcccatgagcttgctttgtgaagacaaacatatgaaaattttgttgcctccctttcgcggcctccttacaaaactcaacaatgattttactaatcctccagtgacttgcattgtttcagatggtttcttgtggatgttcaccattgcagctgctcaagaaattggagtccccatagtgctcttcgaaactattgctgcatcaacgttcatggtgttcacacagtttcgcactttggtccaaaaatggcttgtaccactcaaaggtgaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
UDPGT

Protein Analysis

167

Amino Acids

18.65

Weight (kDa)

7.78

Isoelectric Point (pI)

35.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000097)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g17511 FvH4_3g17550 FvH4_3g17550 FvH4_3g17550 FvH4_6g39790 FvH4_6g39792 FvH4_6g39810 FvH4_6g39810 FvH4_6g39810 FvH4_6g39811 FvH4_6g39813 FvH4_6g39814 FvH4_6g39814 FvH4_6g39840 FvH4_6g39842 FvH4_6g39843 FvH4_6g39845 FvH4_6g39850 FvH4_6g39870 FvH4_6g39871 FvH4_6g39871 FvH4_6g39871 FvH4_6g39872
malus_domestica MD00G1121500.v1.1 MD09G1135900.v1.1 MD09G1136000.v1.1 MD09G1136200.v1.1 MD09G1142300.v1.1 MD09G1142500.v1.1 MD09G1142800.v1.1 MD11G1215800.v1.1 MD13G1225900.v1.1 MD13G1226000.v1.1 MD16G1231000.v1.1 MD16G1231100.v1.1 MD17G1124400.v1.1 MD17G1124800.v1.1 MD17G1124900.v1.1 MD17G1125000.v1.1 MD17G1125400.v1.1 MD17G1125700.v1.1 MD17G1125800.v1.1 MD17G1125900.v1.1 MD17G1126300.v1.1 MD17G1126400.v1.1 MD17G1126700.v1.1 MD17G1126800.v1.1 MD17G1126900.v1.1
prunus_persica Prupe.1G053100_v2.0.a1 Prupe.1G053200_v2.0.a1 Prupe.1G053300_v2.0.a1 Prupe.1G053400_v2.0.a1 Prupe.1G053500_v2.0.a1 Prupe.1G055800_v2.0.a1 Prupe.3G188400_v2.0.a1 Prupe.3G188500_v2.0.a1 Prupe.3G188600_v2.0.a1 Prupe.3G188700_v2.0.a1 Prupe.3G189100_v2.0.a1 Prupe.3G189300_v2.0.a1 Prupe.3G189500_v2.0.a1 Prupe.3G189600_v2.0.a1 Prupe.3G189700_v2.0.a1 Prupe.3G190100_v2.0.a1 Prupe.3G190300_v2.0.a1 Prupe.3G190400_v2.0.a1 Prupe.3G190500_v2.0.a1 Prupe.3G190600_v2.0.a1 Prupe.3G190800_v2.0.a1 Prupe.4G236600_v2.0.a1 Prupe.4G236700_v2.0.a1 Prupe.4G236800_v2.0.a1 Prupe.4G237000_v2.0.a1
pyrus_communis pycom09g05690 pycom09g05700 pycom09g05710 pycom09g05720 pycom09g05730 pycom09g05740 pycom09g05750 pycom09g05760 pycom09g05770 pycom09g06250 pycom09g06260 pycom09g06280 pycom13g19910 pycom16g19350 pycom17g11590 pycom17g11650 pycom17g11670 pycom17g11680 pycom17g11690 pycom17g11760 pycom17g11780 pycom17g11800 pycom17g11820 pycom17g11830 pycom17g11860 pycom17g11870
rosa_chinensis RchiOBHm_Chr1g0340871 RchiOBHm_Chr2g0124501 RchiOBHm_Chr2g0149801 RchiOBHm_Chr2g0149811 RchiOBHm_Chr2g0153911 RchiOBHm_Chr2g0153971 RchiOBHm_Chr2g0153981 RchiOBHm_Chr2g0154001 RchiOBHm_Chr2g0154021 RchiOBHm_Chr2g0154031 RchiOBHm_Chr2g0154041 RchiOBHm_Chr2g0154061 RchiOBHm_Chr2g0154071 RchiOBHm_Chr2g0154151 RchiOBHm_Chr2g0154191 RchiOBHm_Chr2g0154221 RchiOBHm_Chr2g0154301 RchiOBHm_Chr2g0154321 RchiOBHm_Chr2g0154331 RchiOBHm_Chr2g0154341 RchiOBHm_Chr2g0154351 RchiOBHm_Chr2g0154371 RchiOBHm_Chr5g0029061 RchiOBHm_Chr5g0029111 RchiOBHm_Chr5g0029131 RchiOBHm_Chr5g0029151 RchiOBHm_Chr5g0029271 RchiOBHm_Chr5g0038461 RchiOBHm_Chr5g0038821 RchiOBHm_Chr5g0059331 RchiOBHm_Chr7g0211221
rosa_laevigata RLG00000003018 RLG00000009631 RLG00000018804 RLG00000019613 RLG00000019617 RLG00000020446 RLG00000020447 RLG00000020738 RLG00000020742 RLG00000020743 RLG00000020746 RLG00000020752 RLG00000020754 RLG00000020755 RLG00000020756 RLG00000020759 RLG00000020761 RLG00000020762 RLG00000020765 RLG00000020770 RLG00000020771 RLG00000020772 RLG00000020773 RLG00000020774 RLG00000033136 RLG00000033146 RLG00000033148 RLG00000033870 RLG00000033876
rosa_multiflora Rmu_co8137600.1_g000001 Rmu_co8174218.1_g000001 Rmu_co8313823.1_g000001 Rmu_sc0000533.1_g000092 Rmu_sc0000857.1_g000006 Rmu_sc0000857.1_g000021 Rmu_sc0000857.1_g000028 Rmu_sc0001017.1_g000018 Rmu_sc0002214.1_g000001 Rmu_sc0002214.1_g000010 Rmu_sc0002474.1_g000003 Rmu_sc0002474.1_g000011 Rmu_sc0002474.1_g000015 Rmu_sc0003808.1_g000003 Rmu_sc0005195.1_g000001 Rmu_sc0005836.1_g000010 Rmu_sc0006451.1_g000005 Rmu_sc0007313.1_g000006 Rmu_sc0007324.1_g000011 Rmu_sc0012347.1_g000008 Rmu_sc0012977.1_g000001 Rmu_sc0014312.1_g000004 Rmu_sc0014312.1_g000005 Rmu_sc0015490.1_g000001 Rmu_sc0018451.1_g000003 Rmu_sc0022116.1_g000004 Rmu_sc0022116.1_g000005 Rmu_sc0025399.1_g000001 Rmu_sc0031326.1_g000001 Rmu_sc0031654.1_g000002 Rmu_ssc0000308.1_g000037
rosa_roxburghii Rroxscaffold_1G00042160 Rroxscaffold_1G00042210 Rroxscaffold_1G00050730 Rroxscaffold_1G00050780 Rroxscaffold_2G00094400 Rroxscaffold_2G00094410 Rroxscaffold_2G00094420 Rroxscaffold_2G00094440 Rroxscaffold_2G00094470 Rroxscaffold_2G00094480 Rroxscaffold_2G00094490 Rroxscaffold_2G00094510 Rroxscaffold_2G00094520 Rroxscaffold_2G00094530 Rroxscaffold_2G00094540 Rroxscaffold_2G00094550 Rroxscaffold_2G00094560 Rroxscaffold_2G00094590 Rroxscaffold_2G00094660 Rroxscaffold_2G00097680 Rroxscaffold_2G00121030 Rroxscaffold_2G00121040 Rroxscaffold_5G00340200
rosa_rugosa Rorug02G0416600 Rorug02G0416700 Rorug02G0443200 Rorug02G0443400 Rorug02G0443500 Rorug02G0443600 Rorug02G0443700 Rorug02G0443900 Rorug02G0444000 Rorug03G0256900 Rorug03G0257000 Rorug05G0112400 Rorug05G0112600 Rorug05G0174300 Rorug07G0124600
rosa_samantha Rh2BG318500 Rh2BG487300 Rh2BG487500 Rh2BG516900 Rh2BG517000 Rh2BG518000 Rh2BG518100 Rh2BG518300 Rh2BG518400 Rh2BG518500 Rh2BG519400 Rh2BG519500 Rh2BG519600 Rh2BG519700 Rh5BG203100 Rh5BG203500 Rh5BG265800 Rh5BG398100 Rh7CG273600
rosa_wichuraiana Rw2G038790 Rw2G038800 Rw2G041610 Rw2G041620 Rw2G041640 Rw2G041660 Rw2G041670 Rw2G041680 Rw2G041690 Rw2G041700 Rw2G041720 Rw2G041730 Rw2G041740 Rw2G041750 Rw5G018550 Rw5G018570 Rw5G018590 Rw5G018610 Rw5G024410

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 291
AciI CCGC 1 cut(s) 291
AclI AACGTT 1 cut(s) 437
AclWI GGATC 1 cut(s) 227
AcsI RAATTY 1 cut(s) 270
AfaI GTAC 1 cut(s) 486
AfeI AGCGCT 1 cut(s) 140
AfiI CCNNNNNNNGG 4 cut(s) 47, 58, 290, 494
AgsI TTSAA 1 cut(s) 197
AluBI AGCT 4 cut(s) 38, 159, 243, 383
AluI AGCT 4 cut(s) 38, 159, 243, 383
Alw21I GWGCWC 1 cut(s) 414
Alw26I GTCTC 1 cut(s) 182
AlwI GGATC 1 cut(s) 227
AlwNI CAGNNNCTG 1 cut(s) 224
Aor51HI AGCGCT 1 cut(s) 140
AoxI GGCC 3 cut(s) 49, 211, 292
ApeKI GCWGC 3 cut(s) 380, 383, 428
ApoI RAATTY 1 cut(s) 270
AspLEI GCGC 1 cut(s) 141
AspS9I GGNCC 1 cut(s) 469
AsuHPI GGTGA 1 cut(s) 364
AsuII TTCGAA 1 cut(s) 417
AvaII GGWCC 1 cut(s) 469
BbsI GAAGAC 1 cut(s) 261
Bbv12I GWGCWC 1 cut(s) 414
BbvI GCAGC 3 cut(s) 370, 392, 415
BccI CCATC 3 cut(s) 49, 203, 347
BcgI CGANNNNNNTGC 2 cut(s) 407, 441
BcoDI GTCTC 1 cut(s) 182
BfaI CTAG 2 cut(s) 47, 74
BfoI RGCGCY 1 cut(s) 142
BisI GCNGC 4 cut(s) 292, 381, 384, 429
BlsI GCNGC 4 cut(s) 293, 382, 385, 430
Bme18I GGWCC 1 cut(s) 469
BmgT120I GGNCC 1 cut(s) 469
BmsI GCATC 1 cut(s) 440
BpiI GAAGAC 1 cut(s) 261
BpmI CTGGAG 1 cut(s) 315
Bpu14I TTCGAA 1 cut(s) 417
BpuEI CTTGAG 1 cut(s) 372
BsaBI GATNNNNATC 1 cut(s) 231
BsaI GGTCTC 1 cut(s) 182
BsaXI ACNNNNNCTCC 2 cut(s) 313, 343
Bsc4I CCNNNNNNNGG 4 cut(s) 47, 58, 290, 494
Bse1I ACTGG 1 cut(s) 332
Bse3DI GCAATG 1 cut(s) 375
Bse8I GATNNNNATC 1 cut(s) 231
BseGI GGATG 1 cut(s) 372
BseJI GATNNNNATC 1 cut(s) 231
BseLI CCNNNNNNNGG 4 cut(s) 47, 58, 290, 494
BseMI GCAATG 1 cut(s) 375
BseNI ACTGG 1 cut(s) 332
BseXI GCAGC 3 cut(s) 370, 392, 415
Bsh1236I CGCG 1 cut(s) 291
BshFI GGCC 3 cut(s) 51, 213, 294
BsiHKAI GWGCWC 1 cut(s) 414
BslFI GGGAC 1 cut(s) 386
BslI CCNNNNNNNGG 4 cut(s) 47, 58, 290, 494
BsmAI GTCTC 1 cut(s) 182
BsmFI GGGAC 1 cut(s) 386
BsnI GGCC 3 cut(s) 51, 213, 294
Bso31I GGTCTC 1 cut(s) 182
Bsp119I TTCGAA 1 cut(s) 417
Bsp1286I GDGCHC 1 cut(s) 414
Bsp143I GATC 1 cut(s) 232
BspACI CCGC 1 cut(s) 291
BspANI GGCC 3 cut(s) 51, 213, 294
BspFNI CGCG 1 cut(s) 291
BspPI GGATC 1 cut(s) 227
BspQI GCTCTTC 1 cut(s) 419
BspT104I TTCGAA 1 cut(s) 417
BspTNI GGTCTC 1 cut(s) 182
BsrDI GCAATG 1 cut(s) 375
BsrI ACTGG 1 cut(s) 332
BssMI GATC 1 cut(s) 232
Bst4CI ACNGT 2 cut(s) 176, 456
Bst6I CTCTTC 1 cut(s) 419
BstBI TTCGAA 1 cut(s) 417
BstC8I GCNNGC 1 cut(s) 245
BstDEI CTNAG 3 cut(s) 9, 155, 169
BstF5I GGATG 1 cut(s) 372
BstFNI CGCG 1 cut(s) 291
BstH2I RGCGCY 1 cut(s) 142
BstHHI GCGC 1 cut(s) 141
BstKTI GATC 1 cut(s) 235
BstMAI GTCTC 1 cut(s) 182
BstMBI GATC 1 cut(s) 232
BstUI CGCG 1 cut(s) 291
BstV1I GCAGC 3 cut(s) 370, 392, 415
BstV2I GAAGAC 1 cut(s) 261
BsuRI GGCC 3 cut(s) 51, 213, 294
BtsCI GGATG 1 cut(s) 372
BtsIMutI CAGTG 1 cut(s) 339
Cac8I GCNNGC 1 cut(s) 245
CaiI CAGNNNCTG 1 cut(s) 224
CfoI GCGC 1 cut(s) 141
Cfr13I GGNCC 1 cut(s) 469
Csp6I GTAC 1 cut(s) 485
CviAII CATG 3 cut(s) 20, 238, 442
CviQI GTAC 1 cut(s) 485
DdeI CTNAG 3 cut(s) 9, 155, 169
DpnI GATC 1 cut(s) 234
DpnII GATC 1 cut(s) 232
Eam1104I CTCTTC 1 cut(s) 419
EarI CTCTTC 1 cut(s) 419
Eco31I GGTCTC 1 cut(s) 182
Eco47I GGWCC 1 cut(s) 469
Eco47III AGCGCT 1 cut(s) 140
FaeI CATG 3 cut(s) 23, 241, 445
FaqI GGGAC 1 cut(s) 386
FatI CATG 3 cut(s) 19, 237, 441
FauNDI CATATG 1 cut(s) 264
Fnu4HI GCNGC 4 cut(s) 292, 381, 384, 429
FokI GGATG 1 cut(s) 379
Fsp4HI GCNGC 4 cut(s) 292, 381, 384, 429
FspBI CTAG 2 cut(s) 47, 74
GlaI GCGC 1 cut(s) 140
GluI GCNGC 4 cut(s) 292, 381, 384, 429
GsuI CTGGAG 1 cut(s) 315
HaeII RGCGCY 1 cut(s) 142
HaeIII GGCC 3 cut(s) 51, 213, 294
HhaI GCGC 1 cut(s) 141
Hin1II CATG 3 cut(s) 23, 241, 445
Hin6I GCGC 1 cut(s) 139
HinP1I GCGC 1 cut(s) 139
HincII GTYRAC 1 cut(s) 118
HindII GTYRAC 1 cut(s) 118
HinfI GANTC 3 cut(s) 125, 221, 399
HphI GGTGA 1 cut(s) 364
Hpy166II GTNNAC 3 cut(s) 118, 372, 450
Hpy188I TCNGA 3 cut(s) 208, 226, 352
Hpy188III TCNNGA 1 cut(s) 389
Hpy8I GTNNAC 3 cut(s) 118, 372, 450
HpyCH4III ACNGT 2 cut(s) 176, 456
HpyCH4IV ACGT 1 cut(s) 437
HpyCH4V TGCA 3 cut(s) 342, 380, 431
HpyF3I CTNAG 3 cut(s) 9, 155, 169
HpySE526I ACGT 1 cut(s) 437
Hsp92II CATG 3 cut(s) 23, 241, 445
HspAI GCGC 1 cut(s) 139
Kzo9I GATC 1 cut(s) 232
LguI GCTCTTC 1 cut(s) 419
LmnI GCTCC 2 cut(s) 43, 164
LpnPI CCDG 3 cut(s) 48, 231, 345
Lsp1109I GCAGC 3 cut(s) 370, 392, 415
LweI GCATC 1 cut(s) 440
MaeI CTAG 2 cut(s) 47, 74
MaeII ACGT 1 cut(s) 437
MaeIII GTNAC 1 cut(s) 334
MalI GATC 1 cut(s) 234
MboI GATC 1 cut(s) 232
MboII GAAGA 2 cut(s) 266, 406
MhlI GDGCHC 1 cut(s) 414
MluCI AATT 2 cut(s) 270, 393
MlyI GAGTC 2 cut(s) 134, 408
MmeI TCCRAC 1 cut(s) 186
MnlI CCTC 4 cut(s) 27, 291, 305, 339
MseI TTAA 2 cut(s) 69, 147
MspA1I CMGCKG 1 cut(s) 383
MvnI CGCG 1 cut(s) 291
NdeI CATATG 1 cut(s) 264
NdeII GATC 1 cut(s) 232
NlaIII CATG 3 cut(s) 23, 241, 445
NmuCI GTSAC 1 cut(s) 334
NspV TTCGAA 1 cut(s) 417
PciSI GCTCTTC 1 cut(s) 419
PcsI WCGNNNNNNNCGW 1 cut(s) 180
PfeI GAWTC 1 cut(s) 221
PkrI GCNGC 4 cut(s) 293, 382, 385, 430
PleI GAGTC 2 cut(s) 133, 407
PpsI GAGTC 2 cut(s) 133, 407
Psp1406I AACGTT 1 cut(s) 437
PspPI GGNCC 1 cut(s) 469
PstNI CAGNNNCTG 1 cut(s) 224
PvuII CAGCTG 1 cut(s) 383
RsaI GTAC 1 cut(s) 486
RsaNI GTAC 1 cut(s) 485
SapI GCTCTTC 1 cut(s) 419
SaqAI TTAA 2 cut(s) 69, 147
SatI GCNGC 4 cut(s) 292, 381, 384, 429
Sau3AI GATC 1 cut(s) 232
Sau96I GGNCC 1 cut(s) 469
SchI GAGTC 2 cut(s) 134, 408
SduI GDGCHC 1 cut(s) 414
SetI ASST 8 cut(s) 40, 63, 113, 161, 245, 385, 440, 499
SfaNI GCATC 1 cut(s) 440
SfuI TTCGAA 1 cut(s) 417
SinI GGWCC 1 cut(s) 469
SmlI CTYRAG 1 cut(s) 387
SmoI CTYRAG 1 cut(s) 387
Sse9I AATT 2 cut(s) 270, 393
SsiI CCGC 1 cut(s) 291
SspMI CTAG 2 cut(s) 47, 74
TaaI ACNGT 2 cut(s) 176, 456
TaiI ACGT 1 cut(s) 440
TaqI TCGA 1 cut(s) 417
TasI AATT 2 cut(s) 270, 393
TauI GCSGC 1 cut(s) 294
TfiI GAWTC 1 cut(s) 221
Tru1I TTAA 2 cut(s) 69, 147
Tru9I TTAA 2 cut(s) 69, 147
TscAI CASTG 1 cut(s) 339
TseFI GTSAC 1 cut(s) 334
TseI GCWGC 3 cut(s) 380, 383, 428
Tsp45I GTSAC 1 cut(s) 334
TspDTI ATGAA 3 cut(s) 92, 281, 430
TspRI CASTG 1 cut(s) 339
VpaK11BI GGWCC 1 cut(s) 469
XapI RAATTY 1 cut(s) 270
XspI CTAG 2 cut(s) 47, 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.