Rmu_sc0007313.1_g000006

UDP-Glycosyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007313.1
OG0000097
Physical Location & Seq
Reverse (-)
30612 .. 34954
4343 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007313.1_g000006.1.cds

Sequence Viewer

Length: 1416 bp
atggcttacactttcccttctagttccactggaagcacaaagcctcatgctgtttgtactaatgttgcttcccaaagtcacattaaggcgatgctcaaactagccaaaatccttcaccatagaggttttcacattaccttcgtcaacacagaatcctaccacaagcgttttcttgaatctcaaggacccaattccctcaatggcttacctgattttcgctttgaaacccttccagattcagataaaagtgcccccagaaatcatctgttggctccatttcgtgacctgttgatgaaactcaataacactactcctccagtgacttgcattgtttcgaatggcttcatgtccacattcacaatcactgctgcagatgaactagatattcctattgcattgttctacagttttgctgcttgcagcttcatgggattaaagcaattccgcactttgcgggaaaaaggccttgcaccacttaaagatgagagctgtttgacaaatggatttttagacaaagttatagaatggattccaggaatgaaggacatctgtttaaaacatcttccaaccttctttaggaccacaaatcctgatgacaccttgttcaacatctgcatggaaacaacagaagcagcggatagagcttcagcagttgttcttctcacttttgacgcgttggaaaaagatgttttagaagctctctcctcttctttgtctccacctgtttatacaattggtcctctccagttacttctcaaccaaataccagaaaatcctttggaatctattggatacaactttttgaaagaagaaacagaatgtctccaatggatgaactcaaaagctccaaactcagttatttatgtaaattttggcagcaaagccgtcttgacagtagcacagctacttgagtttggatggggattagcaaatactaagcttccattcttctgggttattaggccagatttggttgttggcaaatcgctagttttgcccccagagttcgaagctgaaaccaaagacagaggtctaatcgcaagttggtgcccccaagaacaagtcttaagccacccaacagttggagggtttctaacacatagtggttggaattcaactattgaaagtttgacagctggagtcccgatgctgtgttggccattctttgcagaccagcaaacaaacagttactacacttgtagtaaatggggcattggcatggagataaacaatgatgtcaacagaggtgatgtggaaaaacttgtaaatgagttaatgaagggagagaagtgtaagaaaatgaaaagcaaggtcttggagtggaagaaacttgcggaagaagcaactgctccacatggttcttcatcaataaatttagacaagctagtgaatcaagtgctattgagacaacgctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
UDPGT

Protein Analysis

471

Amino Acids

52.57

Weight (kDa)

6.28

Isoelectric Point (pI)

38.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000097)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g17511 FvH4_3g17550 FvH4_3g17550 FvH4_3g17550 FvH4_6g39790 FvH4_6g39792 FvH4_6g39810 FvH4_6g39810 FvH4_6g39810 FvH4_6g39811 FvH4_6g39813 FvH4_6g39814 FvH4_6g39814 FvH4_6g39840 FvH4_6g39842 FvH4_6g39843 FvH4_6g39845 FvH4_6g39850 FvH4_6g39870 FvH4_6g39871 FvH4_6g39871 FvH4_6g39871 FvH4_6g39872
malus_domestica MD00G1121500.v1.1 MD09G1135900.v1.1 MD09G1136000.v1.1 MD09G1136200.v1.1 MD09G1142300.v1.1 MD09G1142500.v1.1 MD09G1142800.v1.1 MD11G1215800.v1.1 MD13G1225900.v1.1 MD13G1226000.v1.1 MD16G1231000.v1.1 MD16G1231100.v1.1 MD17G1124400.v1.1 MD17G1124800.v1.1 MD17G1124900.v1.1 MD17G1125000.v1.1 MD17G1125400.v1.1 MD17G1125700.v1.1 MD17G1125800.v1.1 MD17G1125900.v1.1 MD17G1126300.v1.1 MD17G1126400.v1.1 MD17G1126700.v1.1 MD17G1126800.v1.1 MD17G1126900.v1.1
prunus_persica Prupe.1G053100_v2.0.a1 Prupe.1G053200_v2.0.a1 Prupe.1G053300_v2.0.a1 Prupe.1G053400_v2.0.a1 Prupe.1G053500_v2.0.a1 Prupe.1G055800_v2.0.a1 Prupe.3G188400_v2.0.a1 Prupe.3G188500_v2.0.a1 Prupe.3G188600_v2.0.a1 Prupe.3G188700_v2.0.a1 Prupe.3G189100_v2.0.a1 Prupe.3G189300_v2.0.a1 Prupe.3G189500_v2.0.a1 Prupe.3G189600_v2.0.a1 Prupe.3G189700_v2.0.a1 Prupe.3G190100_v2.0.a1 Prupe.3G190300_v2.0.a1 Prupe.3G190400_v2.0.a1 Prupe.3G190500_v2.0.a1 Prupe.3G190600_v2.0.a1 Prupe.3G190800_v2.0.a1 Prupe.4G236600_v2.0.a1 Prupe.4G236700_v2.0.a1 Prupe.4G236800_v2.0.a1 Prupe.4G237000_v2.0.a1
pyrus_communis pycom09g05690 pycom09g05700 pycom09g05710 pycom09g05720 pycom09g05730 pycom09g05740 pycom09g05750 pycom09g05760 pycom09g05770 pycom09g06250 pycom09g06260 pycom09g06280 pycom13g19910 pycom16g19350 pycom17g11590 pycom17g11650 pycom17g11670 pycom17g11680 pycom17g11690 pycom17g11760 pycom17g11780 pycom17g11800 pycom17g11820 pycom17g11830 pycom17g11860 pycom17g11870
rosa_chinensis RchiOBHm_Chr1g0340871 RchiOBHm_Chr2g0124501 RchiOBHm_Chr2g0149801 RchiOBHm_Chr2g0149811 RchiOBHm_Chr2g0153911 RchiOBHm_Chr2g0153971 RchiOBHm_Chr2g0153981 RchiOBHm_Chr2g0154001 RchiOBHm_Chr2g0154021 RchiOBHm_Chr2g0154031 RchiOBHm_Chr2g0154041 RchiOBHm_Chr2g0154061 RchiOBHm_Chr2g0154071 RchiOBHm_Chr2g0154151 RchiOBHm_Chr2g0154191 RchiOBHm_Chr2g0154221 RchiOBHm_Chr2g0154301 RchiOBHm_Chr2g0154321 RchiOBHm_Chr2g0154331 RchiOBHm_Chr2g0154341 RchiOBHm_Chr2g0154351 RchiOBHm_Chr2g0154371 RchiOBHm_Chr5g0029061 RchiOBHm_Chr5g0029111 RchiOBHm_Chr5g0029131 RchiOBHm_Chr5g0029151 RchiOBHm_Chr5g0029271 RchiOBHm_Chr5g0038461 RchiOBHm_Chr5g0038821 RchiOBHm_Chr5g0059331 RchiOBHm_Chr7g0211221
rosa_laevigata RLG00000003018 RLG00000009631 RLG00000018804 RLG00000019613 RLG00000019617 RLG00000020446 RLG00000020447 RLG00000020738 RLG00000020742 RLG00000020743 RLG00000020746 RLG00000020752 RLG00000020754 RLG00000020755 RLG00000020756 RLG00000020759 RLG00000020761 RLG00000020762 RLG00000020765 RLG00000020770 RLG00000020771 RLG00000020772 RLG00000020773 RLG00000020774 RLG00000033136 RLG00000033146 RLG00000033148 RLG00000033870 RLG00000033876
rosa_multiflora Rmu_co8137600.1_g000001 Rmu_co8174218.1_g000001 Rmu_co8313823.1_g000001 Rmu_sc0000533.1_g000092 Rmu_sc0000857.1_g000006 Rmu_sc0000857.1_g000021 Rmu_sc0000857.1_g000028 Rmu_sc0001017.1_g000018 Rmu_sc0002214.1_g000001 Rmu_sc0002214.1_g000010 Rmu_sc0002474.1_g000003 Rmu_sc0002474.1_g000011 Rmu_sc0002474.1_g000015 Rmu_sc0003808.1_g000003 Rmu_sc0005195.1_g000001 Rmu_sc0005836.1_g000010 Rmu_sc0006451.1_g000005 Rmu_sc0007313.1_g000006 Rmu_sc0007324.1_g000011 Rmu_sc0012347.1_g000008 Rmu_sc0012977.1_g000001 Rmu_sc0014312.1_g000004 Rmu_sc0014312.1_g000005 Rmu_sc0015490.1_g000001 Rmu_sc0018451.1_g000003 Rmu_sc0022116.1_g000004 Rmu_sc0022116.1_g000005 Rmu_sc0025399.1_g000001 Rmu_sc0031326.1_g000001 Rmu_sc0031654.1_g000002 Rmu_ssc0000308.1_g000037
rosa_roxburghii Rroxscaffold_1G00042160 Rroxscaffold_1G00042210 Rroxscaffold_1G00050730 Rroxscaffold_1G00050780 Rroxscaffold_2G00094400 Rroxscaffold_2G00094410 Rroxscaffold_2G00094420 Rroxscaffold_2G00094440 Rroxscaffold_2G00094470 Rroxscaffold_2G00094480 Rroxscaffold_2G00094490 Rroxscaffold_2G00094510 Rroxscaffold_2G00094520 Rroxscaffold_2G00094530 Rroxscaffold_2G00094540 Rroxscaffold_2G00094550 Rroxscaffold_2G00094560 Rroxscaffold_2G00094590 Rroxscaffold_2G00094660 Rroxscaffold_2G00097680 Rroxscaffold_2G00121030 Rroxscaffold_2G00121040 Rroxscaffold_5G00340200
rosa_rugosa Rorug02G0416600 Rorug02G0416700 Rorug02G0443200 Rorug02G0443400 Rorug02G0443500 Rorug02G0443600 Rorug02G0443700 Rorug02G0443900 Rorug02G0444000 Rorug03G0256900 Rorug03G0257000 Rorug05G0112400 Rorug05G0112600 Rorug05G0174300 Rorug07G0124600
rosa_samantha Rh2BG318500 Rh2BG487300 Rh2BG487500 Rh2BG516900 Rh2BG517000 Rh2BG518000 Rh2BG518100 Rh2BG518300 Rh2BG518400 Rh2BG518500 Rh2BG519400 Rh2BG519500 Rh2BG519600 Rh2BG519700 Rh5BG203100 Rh5BG203500 Rh5BG265800 Rh5BG398100 Rh7CG273600
rosa_wichuraiana Rw2G038790 Rw2G038800 Rw2G041610 Rw2G041620 Rw2G041640 Rw2G041660 Rw2G041670 Rw2G041680 Rw2G041690 Rw2G041700 Rw2G041720 Rw2G041730 Rw2G041740 Rw2G041750 Rw5G018550 Rw5G018570 Rw5G018590 Rw5G018610 Rw5G024410

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 1047
AccB7I CCANNNNNTGG 1 cut(s) 1082
AccII CGCG 1 cut(s) 674
AciI CCGC 4 cut(s) 445, 454, 635, 1334
AcoI YGGCCR 1 cut(s) 1157
AcsI RAATTY 3 cut(s) 868, 1111, 1372
AcuI CTGAAG 1 cut(s) 630
AdeI CACNNNGTG 1 cut(s) 1103
AfaI GTAC 1 cut(s) 58
AfiI CCNNNNNNNGG 2 cut(s) 576, 1082
AflII CTTAAG 1 cut(s) 1066
AflIII ACRYGT 1 cut(s) 672
AgsI TTSAA 6 cut(s) 176, 224, 607, 805, 1116, 1124
AjnI CCWGG 1 cut(s) 532
Alw26I GTCTC 3 cut(s) 720, 827, 1399
AoxI GGCC 3 cut(s) 463, 962, 1157
ApeKI GCWGC 5 cut(s) 368, 413, 420, 632, 876
ApoI RAATTY 3 cut(s) 868, 1111, 1372
Asp700I GAANNNNTTC 3 cut(s) 228, 341, 528
AspS9I GGNCC 3 cut(s) 185, 579, 737
AsuHPI GGTGA 2 cut(s) 107, 1259
AsuII TTCGAA 2 cut(s) 335, 1008
AvaII GGWCC 3 cut(s) 185, 579, 737
BaeGI GKGCMC 2 cut(s) 253, 1052
BalI TGGCCA 1 cut(s) 1159
BanI GGYRCC 1 cut(s) 1047
BbvI GCAGC 5 cut(s) 355, 400, 432, 644, 888
BccI CCATC 1 cut(s) 912
BceAI ACGGC 1 cut(s) 869
BciT130I CCWGG 1 cut(s) 534
BciVI GTATCC 1 cut(s) 785
BcoDI GTCTC 3 cut(s) 720, 827, 1399
BfaI CTAG 6 cut(s) 21, 101, 380, 989, 1385, 1414
BfmI CTRYAG 2 cut(s) 369, 403
BfrI CTTAAG 1 cut(s) 1066
BfuI GTATCC 1 cut(s) 785
BisI GCNGC 5 cut(s) 369, 414, 421, 633, 877
BlsI GCNGC 5 cut(s) 370, 415, 422, 634, 878
Bme1390I CCNGG 1 cut(s) 534
Bme18I GGWCC 3 cut(s) 185, 579, 737
BmgT120I GGNCC 3 cut(s) 185, 579, 737
BmiI GGNNCC 3 cut(s) 187, 273, 1049
BmrFI CCNGG 1 cut(s) 534
BmsI GCATC 2 cut(s) 81, 1137
BoxI GACNNNNGTC 1 cut(s) 1029
BpmI CTGGAG 3 cut(s) 300, 728, 1158
Bpu14I TTCGAA 2 cut(s) 335, 1008
BpuEI CTTGAG 2 cut(s) 165, 929
BsaXI ACNNNNNCTCC 2 cut(s) 298, 328
Bsc4I CCNNNNNNNGG 2 cut(s) 576, 1082
Bse1I ACTGG 3 cut(s) 34, 317, 745
BseBI CCWGG 1 cut(s) 534
BseGI GGATG 2 cut(s) 837, 923
BseLI CCNNNNNNNGG 2 cut(s) 576, 1082
BseMII CTCAG 1 cut(s) 867
BseNI ACTGG 3 cut(s) 34, 317, 745
BseRI GAGGAG 2 cut(s) 303, 694
BseSI GKGCMC 2 cut(s) 253, 1052
BseXI GCAGC 5 cut(s) 355, 400, 432, 644, 888
Bsh1236I CGCG 1 cut(s) 674
BshFI GGCC 3 cut(s) 465, 964, 1159
BshNI GGYRCC 1 cut(s) 1047
BslFI GGGAC 1 cut(s) 1127
BslI CCNNNNNNNGG 2 cut(s) 576, 1082
BsmAI GTCTC 3 cut(s) 720, 827, 1399
BsmFI GGGAC 1 cut(s) 1127
BsnI GGCC 3 cut(s) 465, 964, 1159
Bsp119I TTCGAA 2 cut(s) 335, 1008
Bsp1286I GDGCHC 2 cut(s) 253, 1052
BspACI CCGC 4 cut(s) 445, 454, 635, 1334
BspANI GGCC 3 cut(s) 465, 964, 1159
BspCNI CTCAG 1 cut(s) 866
BspFNI CGCG 1 cut(s) 674
BspLI GGNNCC 3 cut(s) 187, 273, 1049
BspMAI CTGCAG 1 cut(s) 373
BspT104I TTCGAA 2 cut(s) 335, 1008
BspT107I GGYRCC 1 cut(s) 1047
BspTI CTTAAG 1 cut(s) 1066
BsrI ACTGG 3 cut(s) 34, 317, 745
Bst2UI CCWGG 1 cut(s) 534
Bst4CI ACNGT 4 cut(s) 407, 895, 1081, 1187
Bst6I CTCTTC 1 cut(s) 712
BstAFI CTTAAG 1 cut(s) 1066
BstBI TTCGAA 2 cut(s) 335, 1008
BstC8I GCNNGC 1 cut(s) 418
BstDEI CTNAG 2 cut(s) 853, 936
BstENI CCTNNNNNAGG 1 cut(s) 574
BstF5I GGATG 2 cut(s) 837, 923
BstFNI CGCG 1 cut(s) 674
BstMAI GTCTC 3 cut(s) 720, 827, 1399
BstMWI GCNNNNNNNGC 4 cut(s) 641, 994, 1156, 1340
BstNI CCWGG 1 cut(s) 534
BstPAI GACNNNNGTC 1 cut(s) 1029
BstSCI CCNGG 1 cut(s) 532
BstSFI CTRYAG 2 cut(s) 369, 403
BstSLI GKGCMC 2 cut(s) 253, 1052
BstUI CGCG 1 cut(s) 674
BstV1I GCAGC 5 cut(s) 355, 400, 432, 644, 888
BstXI CCANNNNNNTGG 1 cut(s) 951
BsuI GTATCC 1 cut(s) 785
BsuRI GGCC 3 cut(s) 465, 964, 1159
BtgZI GCGATG 1 cut(s) 104
BtsCI GGATG 2 cut(s) 837, 923
BtsI GCAGTG 1 cut(s) 363
BtsIMutI CAGTG 3 cut(s) 27, 324, 363
Cac8I GCNNGC 1 cut(s) 418
Cfr13I GGNCC 3 cut(s) 185, 579, 737
CseI GACGC 1 cut(s) 680
Csp6I GTAC 1 cut(s) 57
CviAII CATG 6 cut(s) 47, 346, 427, 616, 1219, 1355
CviQI GTAC 1 cut(s) 57
DdeI CTNAG 2 cut(s) 853, 936
DraI TTTAAA 1 cut(s) 555
DraIII CACNNNGTG 1 cut(s) 1103
EaeI YGGCCR 1 cut(s) 1157
Eam1104I CTCTTC 1 cut(s) 712
EarI CTCTTC 1 cut(s) 712
Eco147I AGGCCT 1 cut(s) 465
Eco47I GGWCC 3 cut(s) 185, 579, 737
Eco57I CTGAAG 1 cut(s) 630
EcoNI CCTNNNNNAGG 1 cut(s) 574
EcoO109I RGGNCCY 1 cut(s) 185
EcoRI GAATTC 1 cut(s) 1111
EcoRII CCWGG 1 cut(s) 532
FaeI CATG 6 cut(s) 50, 349, 430, 619, 1222, 1358
FaqI GGGAC 1 cut(s) 1127
FatI CATG 6 cut(s) 46, 345, 426, 615, 1218, 1354
FauI CCCGC 1 cut(s) 447
Fnu4HI GCNGC 5 cut(s) 369, 414, 421, 633, 877
FokI GGATG 2 cut(s) 844, 930
Fsp4HI GCNGC 5 cut(s) 369, 414, 421, 633, 877
FspBI CTAG 6 cut(s) 21, 101, 380, 989, 1385, 1414
GluI GCNGC 5 cut(s) 369, 414, 421, 633, 877
GsuI CTGGAG 3 cut(s) 300, 728, 1158
HaeIII GGCC 3 cut(s) 465, 964, 1159
HgaI GACGC 1 cut(s) 680
Hin1II CATG 6 cut(s) 50, 349, 430, 619, 1222, 1358
HincII GTYRAC 2 cut(s) 145, 1240
HindII GTYRAC 2 cut(s) 145, 1240
HindIII AAGCTT 1 cut(s) 938
HinfI GANTC 7 cut(s) 152, 176, 236, 529, 782, 1140, 1390
HphI GGTGA 2 cut(s) 107, 1259
Hpy166II GTNNAC 3 cut(s) 145, 351, 1240
Hpy188I TCNGA 1 cut(s) 241
Hpy188III TCNNGA 6 cut(s) 173, 233, 281, 590, 889, 1144
Hpy8I GTNNAC 3 cut(s) 145, 351, 1240
HpyAV CCTTC 7 cut(s) 27, 122, 148, 239, 535, 580, 1273
HpyCH4III ACNGT 4 cut(s) 407, 895, 1081, 1187
HpyCH4V TGCA 7 cut(s) 327, 371, 395, 420, 470, 615, 1169
HpyF10VI GCNNNNNNNGC 4 cut(s) 641, 994, 1156, 1340
HpyF3I CTNAG 2 cut(s) 853, 936
Hsp92II CATG 6 cut(s) 50, 349, 430, 619, 1222, 1358
LmnI GCTCC 3 cut(s) 277, 850, 1354
Lsp1109I GCAGC 5 cut(s) 355, 400, 432, 644, 888
LweI GCATC 2 cut(s) 81, 1137
MaeI CTAG 6 cut(s) 21, 101, 380, 989, 1385, 1414
MaeIII GTNAC 5 cut(s) 77, 281, 319, 747, 1187
MboII GAAGA 8 cut(s) 554, 650, 699, 821, 940, 1336, 1349, 1353
MfeI CAATTG 1 cut(s) 732
MhlI GDGCHC 2 cut(s) 253, 1052
MlsI TGGCCA 1 cut(s) 1159
MluCI AATT 6 cut(s) 190, 440, 732, 868, 1111, 1372
MluI ACGCGT 1 cut(s) 672
MluNI TGGCCA 1 cut(s) 1159
MlyI GAGTC 1 cut(s) 1149
MmeI TCCRAC 4 cut(s) 590, 657, 1063, 1088
MnlI CCTC 9 cut(s) 54, 116, 206, 324, 715, 750, 1022, 1079, 1238
Mox20I TGGCCA 1 cut(s) 1159
MroXI GAANNNNTTC 3 cut(s) 228, 341, 528
MscI TGGCCA 1 cut(s) 1159
MseI TTAA 6 cut(s) 84, 434, 477, 554, 1067, 1274
MslI CAYNNNNRTG 2 cut(s) 614, 1217
Msp20I TGGCCA 1 cut(s) 1159
MspA1I CMGCKG 2 cut(s) 635, 1136
MspCI CTTAAG 1 cut(s) 1066
MspR9I CCNGG 1 cut(s) 534
MunI CAATTG 1 cut(s) 732
MvaI CCWGG 1 cut(s) 534
MvnI CGCG 1 cut(s) 674
MwoI GCNNNNNNNGC 4 cut(s) 641, 994, 1156, 1340
NlaIII CATG 6 cut(s) 50, 349, 430, 619, 1222, 1358
NlaIV GGNNCC 3 cut(s) 187, 273, 1049
NmuCI GTSAC 3 cut(s) 77, 281, 319
NspV TTCGAA 2 cut(s) 335, 1008
PceI AGGCCT 1 cut(s) 465
PdmI GAANNNNTTC 3 cut(s) 228, 341, 528
PfeI GAWTC 6 cut(s) 152, 176, 236, 529, 782, 1390
PflMI CCANNNNNTGG 1 cut(s) 1082
PfoI TCCNGGA 1 cut(s) 532
PkrI GCNGC 5 cut(s) 370, 415, 422, 634, 878
PleI GAGTC 1 cut(s) 1148
PpsI GAGTC 1 cut(s) 1148
PpuMI RGGWCCY 1 cut(s) 185
PshAI GACNNNNGTC 1 cut(s) 1029
Psp5II RGGWCCY 1 cut(s) 185
Psp6I CCWGG 1 cut(s) 532
PspGI CCWGG 1 cut(s) 532
PspN4I GGNNCC 3 cut(s) 187, 273, 1049
PspPI GGNCC 3 cut(s) 185, 579, 737
PspPPI RGGWCCY 1 cut(s) 185
PstI CTGCAG 1 cut(s) 373
PvuII CAGCTG 1 cut(s) 1136
RsaI GTAC 1 cut(s) 58
RsaNI GTAC 1 cut(s) 57
RseI CAYNNNNRTG 2 cut(s) 614, 1217
SaqAI TTAA 6 cut(s) 84, 434, 477, 554, 1067, 1274
SatI GCNGC 5 cut(s) 369, 414, 421, 633, 877
Sau96I GGNCC 3 cut(s) 185, 579, 737
SchI GAGTC 1 cut(s) 1149
ScrFI CCNGG 1 cut(s) 534
SduI GDGCHC 2 cut(s) 253, 1052
SfaNI GCATC 2 cut(s) 81, 1137
SfcI CTRYAG 2 cut(s) 369, 403
SfuI TTCGAA 2 cut(s) 335, 1008
SinI GGWCC 3 cut(s) 185, 579, 737
SmiMI CAYNNNNRTG 2 cut(s) 614, 1217
SmlI CTYRAG 3 cut(s) 180, 908, 1066
SmoI CTYRAG 3 cut(s) 180, 908, 1066
Sse9I AATT 6 cut(s) 190, 440, 732, 868, 1111, 1372
SseBI AGGCCT 1 cut(s) 465
SsiI CCGC 4 cut(s) 445, 454, 635, 1334
SspMI CTAG 6 cut(s) 21, 101, 380, 989, 1385, 1414
StuI AGGCCT 1 cut(s) 465
StyD4I CCNGG 1 cut(s) 532
TaaI ACNGT 4 cut(s) 407, 895, 1081, 1187
TaqI TCGA 2 cut(s) 335, 1008
TasI AATT 6 cut(s) 190, 440, 732, 868, 1111, 1372
TatI WGTACW 1 cut(s) 56
TfiI GAWTC 6 cut(s) 152, 176, 236, 529, 782, 1390
Tru1I TTAA 6 cut(s) 84, 434, 477, 554, 1067, 1274
Tru9I TTAA 6 cut(s) 84, 434, 477, 554, 1067, 1274
TscAI CASTG 3 cut(s) 34, 324, 370
TseFI GTSAC 3 cut(s) 77, 281, 319
TseI GCWGC 5 cut(s) 368, 413, 420, 632, 876
Tsp45I GTSAC 3 cut(s) 77, 281, 319
TspDTI ATGAA 9 cut(s) 308, 334, 390, 415, 554, 848, 1292, 1316, 1353
TspRI CASTG 3 cut(s) 34, 324, 370
Van91I CCANNNNNTGG 1 cut(s) 1082
Vha464I CTTAAG 1 cut(s) 1066
VpaK11BI GGWCC 3 cut(s) 185, 579, 737
XagI CCTNNNNNAGG 1 cut(s) 574
XapI RAATTY 3 cut(s) 868, 1111, 1372
XcmI CCANNNNNNNNNTGG 1 cut(s) 1079
XmnI GAANNNNTTC 3 cut(s) 228, 341, 528
XspI CTAG 6 cut(s) 21, 101, 380, 989, 1385, 1414
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.