Rmu_sc0011258.1_g000006
NAC Family

(NAC) domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011258.1
Physical Location & Seq
Reverse (-)
31609 .. 34221
2613 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011258.1_g000006.1.cds

Sequence Viewer

Length: 1401 bp
atgtgctgcggcggcttcacagttctgaagggataccgattccatccctccgacgaggagctgcttagtcactacttggagcagaagaataagtgcaaggactcccagatcactaccatcatccctgaaatcgatgtgtgcaagcacgagcctcgcgagttgccagataaaccatctccggaacccgaacaccatcaatttcagctattaatgatcatgataaggaaaccatctcgcgagttgccaagcaaggaccgtgcaatcaaggcctccggctccaaagctgtgattgggagaaagaggaccttgaccttctacaaacgtggagtgccgaaatcccagaagaccagctgggttattcatgagtattatctcattcaggcacattctgatcctcctaagcagataggggactttgttgtttgctgcttgcagtacaaatcagacaactttgatcatgataaggatgctccattctgcgatcgaggtagcagtagctgcagtatggcgtccaatgttgtaaatcaagctcaagaaaattgggcgtcgaaagagctggctaatgttgttccaattcccagtggaaatgatgaggaagctgaaactggtggtggtatgattacagaagaagaggagtacctgactttaaaggagctgagagatgctcttcagattcccattggtaatccgcatgaattcgaagtccaaggcacgcaaactgatccttgtcctatagataagaatgatctttcaaccactgttgaaggccaacctgatagaagcaattcatctgatatgattaaagagctactagatgacccagaaaatctggattcactctttcatcagcctgcaccacctcaactacataactcaccaatgtataccaccaatgtccataataatgaatgtcgtaagaggacatgtccatttgaggataataacccttctcttacgaagaagaatattatttccacaaatgatgatgacgaattagttagcaacaccacatgtggttctgaaaataaagctgcaaatatgattccagagggatattctcaactaggagcaaatctgggattagaatttgattcatttctgccaaacgattacgattatacattaccatcaataaacggaggactgagagatttttcccaggacaataatttcattgagttggatgatttactatcttcatacgaaggtattgactcttctctcgcacagttcctacatacagttattgatggaggtagaggagtgaccagtgacagaaataccgaagtagtacacggatcggcagtgaggctgcaggggcattgtactgctgtttatctgccccagaagaaactgaaagtcctggaagcagacaacagttcaaagctggcagcaatataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

466

Amino Acids

51.99

Weight (kDa)

4.96

Isoelectric Point (pI)

45.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000639)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g18020 FvH4_7g18020 FvH4_7g18020 FvH4_7g18020 FvH4_7g18020 FvH4_7g18020 FvH4_7g18020 FvH4_7g18020 FvH4_7g18020
rosa_chinensis RchiOBHm_Chr1g0324821 RchiOBHm_Chr1g0333801 RchiOBHm_Chr1g0361601 RchiOBHm_Chr1g0361611 RchiOBHm_Chr1g0361661
rosa_laevigata RLG00000027711 RLG00000027712 RLG00000027714 RLG00000027715 RLG00000027716 RLG00000029530 RLG00000029531 RLG00000030172
rosa_multiflora Rmu_co8302323.1_g000001 Rmu_co8459497.1_g000001 Rmu_sc0003426.1_g000013 Rmu_sc0003693.1_g000002 Rmu_sc0003693.1_g000003 Rmu_sc0003704.1_g000001 Rmu_sc0003704.1_g000002 Rmu_sc0006101.1_g000001 Rmu_sc0006101.1_g000010 Rmu_sc0006417.1_g000001 Rmu_sc0006417.1_g000002 Rmu_sc0006417.1_g000005 Rmu_sc0007217.1_g000011 Rmu_sc0010981.1_g000006 Rmu_sc0011258.1_g000006 Rmu_sc0017253.1_g000003 Rmu_sc0017253.1_g000004 Rmu_sc0017750.1_g000001 Rmu_sc0026316.1_g000001 Rmu_sc0038193.1_g000002 Rmu_sc0041549.1_g000001
rosa_roxburghii Rroxscaffold_159G00433000 Rroxscaffold_159G00433050 Rroxscaffold_159G00433080 Rroxscaffold_4G00294830 Rroxscaffold_4G00294840 Rroxscaffold_4G00294900 Rroxscaffold_4G00294910 Rroxscaffold_4G00294920 Rroxscaffold_4G00317230 Rroxscaffold_4G00325170 Rroxscaffold_4G00325200 Rroxscaffold_4G00325280
rosa_rugosa Rorug01G0048000 Rorug01G0111600 Rorug01G0111700 Rorug01G0290200 Rorug01G0290300 Rorug01G0290300 Rorug01G0290400 Rorug01G0290600
rosa_samantha Rh1AG064300 Rh1AG064500 Rh1AG134000 Rh1AG134100 Rh1AG300500 Rh1AG300600
rosa_wichuraiana Rw1G005340 Rw1G005390 Rw1G005420 Rw1G011180 Rw1G011190 Rw1G026650 Rw1G026660 Rw1G026680 Rw1G026690

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 884
AccII CGCG 2 cut(s) 156, 237
AccIII TCCGGA 1 cut(s) 178
AciI CCGC 3 cut(s) 9, 12, 689
AclWI GGATC 3 cut(s) 386, 716, 1306
AcsI RAATTY 2 cut(s) 695, 1085
AcuI CTGAAG 2 cut(s) 47, 653
AcyI GRCGYC 2 cut(s) 509, 545
AfaI GTAC 4 cut(s) 437, 638, 1293, 1327
AflIII ACRYGT 2 cut(s) 923, 1010
AgsI TTSAA 3 cut(s) 753, 764, 1383
AjnI CCWGG 2 cut(s) 1158, 1362
AlwI GGATC 3 cut(s) 386, 716, 1306
AlwNI CAGNNNCTG 1 cut(s) 498
Aor13HI TCCGGA 1 cut(s) 178
AoxI GGCC 2 cut(s) 267, 766
ApeKI GCWGC 7 cut(s) 6, 61, 426, 498, 1031, 1312, 1391
ApoI RAATTY 2 cut(s) 695, 1085
AseI ATTAAT 1 cut(s) 209
Asp700I GAANNNNTTC 1 cut(s) 784
AspS9I GGNCC 2 cut(s) 253, 303
AsuHPI GGTGA 1 cut(s) 867
AsuII TTCGAA 1 cut(s) 699
AvaII GGWCC 2 cut(s) 253, 303
BarI GAAGNNNNNNTAC 2 cut(s) 1201, 1233
BauI CACGAG 1 cut(s) 146
BbsI GAAGAC 1 cut(s) 350
BbvI GCAGC 5 cut(s) 48, 413, 485, 1018, 1299
BccI CCATC 7 cut(s) 51, 125, 181, 201, 238, 1135, 1244
BcgI CGANNNNNNTGC 2 cut(s) 134, 168
BciT130I CCWGG 2 cut(s) 1160, 1364
BciVI GTATCC 1 cut(s) 26
BclI TGATCA 2 cut(s) 213, 454
BfaI CTAG 2 cut(s) 812, 1064
BfmI CTRYAG 3 cut(s) 499, 732, 1313
BfuI GTATCC 1 cut(s) 26
BisI GCNGC 9 cut(s) 7, 10, 13, 62, 427, 499, 1032, 1313, 1392
BlsI GCNGC 9 cut(s) 8, 11, 14, 63, 428, 500, 1033, 1314, 1393
Bme1390I CCNGG 2 cut(s) 1160, 1364
Bme18I GGWCC 2 cut(s) 253, 303
BmgT120I GGNCC 2 cut(s) 253, 303
BmiI GGNNCC 2 cut(s) 183, 277
BmrFI CCNGG 2 cut(s) 1160, 1364
BmrI ACTGGG 1 cut(s) 573
BmsI GCATC 2 cut(s) 457, 652
BmuI ACTGGG 1 cut(s) 573
BpiI GAAGAC 1 cut(s) 350
BplI GAGNNNNNCTC 2 cut(s) 649, 681
Bpu10I CCTNAGC 1 cut(s) 399
Bpu14I TTCGAA 1 cut(s) 699
BpuEI CTTGAG 1 cut(s) 516
Bsa29I ATCGAT 1 cut(s) 132
BsaHI GRCGYC 2 cut(s) 509, 545
BsaJI CCNNGG 2 cut(s) 706, 1158
BsaWI WCCGGW 1 cut(s) 178
Bse1I ACTGG 3 cut(s) 579, 610, 1269
BseAI TCCGGA 1 cut(s) 178
BseBI CCWGG 2 cut(s) 1160, 1364
BseCI ATCGAT 1 cut(s) 132
BseDI CCNNGG 2 cut(s) 706, 1158
BseGI GGATG 4 cut(s) 43, 120, 472, 1189
BseMII CTCAG 2 cut(s) 647, 1136
BseNI ACTGG 3 cut(s) 579, 610, 1269
BseRI GAGGAG 3 cut(s) 71, 647, 1275
BseXI GCAGC 5 cut(s) 48, 413, 485, 1018, 1299
BseYI CCCAGC 1 cut(s) 351
BsgI GTGCAG 1 cut(s) 837
Bsh1236I CGCG 2 cut(s) 156, 237
Bsh1285I CGRYCG 1 cut(s) 484
BshFI GGCC 2 cut(s) 269, 768
BshVI ATCGAT 1 cut(s) 132
BsiEI CGRYCG 1 cut(s) 484
BsiSI CCGG 2 cut(s) 179, 273
BslFI GGGAC 1 cut(s) 425
BsmFI GGGAC 1 cut(s) 425
BsnI GGCC 2 cut(s) 269, 768
Bsp119I TTCGAA 1 cut(s) 699
Bsp13I TCCGGA 1 cut(s) 178
Bsp143I GATC 8 cut(s) 108, 213, 391, 454, 481, 721, 745, 1298
Bsp68I TCGCGA 2 cut(s) 156, 237
BspACI CCGC 3 cut(s) 9, 12, 689
BspANI GGCC 2 cut(s) 269, 768
BspCNI CTCAG 2 cut(s) 648, 1137
BspDI ATCGAT 1 cut(s) 132
BspEI TCCGGA 1 cut(s) 178
BspFNI CGCG 2 cut(s) 156, 237
BspHI TCATGA 3 cut(s) 216, 361, 457
BspLI GGNNCC 2 cut(s) 183, 277
BspMAI CTGCAG 2 cut(s) 503, 1317
BspPI GGATC 3 cut(s) 386, 716, 1306
BspQI GCTCTTC 1 cut(s) 672
BspT104I TTCGAA 1 cut(s) 699
BsrI ACTGG 3 cut(s) 579, 610, 1269
BssECI CCNNGG 2 cut(s) 706, 1158
BssMI GATC 8 cut(s) 108, 213, 391, 454, 481, 721, 745, 1298
BssNAI GTATAC 1 cut(s) 885
BssNI GRCGYC 2 cut(s) 509, 545
BssSI CACGAG 1 cut(s) 146
BssT1I CCWWGG 1 cut(s) 706
Bst1107I GTATAC 1 cut(s) 885
Bst2BI CACGAG 1 cut(s) 146
Bst2UI CCWGG 2 cut(s) 1160, 1364
Bst4CI ACNGT 6 cut(s) 22, 257, 760, 1230, 1243, 1379
Bst6I CTCTTC 3 cut(s) 624, 672, 1222
BstACI GRCGYC 2 cut(s) 509, 545
BstAPI GCANNNNNTGC 1 cut(s) 498
BstBI TTCGAA 1 cut(s) 699
BstC8I GCNNGC 6 cut(s) 143, 431, 558, 713, 852, 1389
BstDEI CTNAG 4 cut(s) 65, 399, 656, 1145
BstF5I GGATG 4 cut(s) 43, 120, 472, 1189
BstFNI CGCG 2 cut(s) 156, 237
BstKTI GATC 8 cut(s) 111, 216, 394, 457, 484, 724, 748, 1301
BstMBI GATC 8 cut(s) 108, 213, 391, 454, 481, 721, 745, 1298
BstMCI CGRYCG 1 cut(s) 484
BstMWI GCNNNNNNNGC 4 cut(s) 12, 266, 498, 1318
BstNI CCWGG 2 cut(s) 1160, 1364
BstNSI RCATGY 2 cut(s) 927, 1014
BstSCI CCNGG 2 cut(s) 1158, 1362
BstSFI CTRYAG 3 cut(s) 499, 732, 1313
BstUI CGCG 2 cut(s) 156, 237
BstV1I GCAGC 5 cut(s) 48, 413, 485, 1018, 1299
BstV2I GAAGAC 1 cut(s) 350
BstZ17I GTATAC 1 cut(s) 885
Bsu15I ATCGAT 1 cut(s) 132
BsuI GTATCC 1 cut(s) 26
BsuRI GGCC 2 cut(s) 269, 768
BsuTUI ATCGAT 1 cut(s) 132
BtsCI GGATG 4 cut(s) 43, 120, 472, 1189
BtsI GCAGTG 1 cut(s) 1311
BtsIMutI CAGTG 4 cut(s) 586, 756, 1276, 1311
BtuMI TCGCGA 2 cut(s) 156, 237
Cac8I GCNNGC 6 cut(s) 143, 431, 558, 713, 852, 1389
CaiI CAGNNNCTG 1 cut(s) 498
CciI TCATGA 3 cut(s) 216, 361, 457
Cfr13I GGNCC 2 cut(s) 253, 303
ClaI ATCGAT 1 cut(s) 132
CseI GACGC 2 cut(s) 498, 534
Csp6I GTAC 4 cut(s) 436, 637, 1292, 1326
CviAII CATG 6 cut(s) 217, 362, 458, 692, 924, 1011
CviQI GTAC 4 cut(s) 436, 637, 1292, 1326
DdeI CTNAG 4 cut(s) 65, 399, 656, 1145
DpnI GATC 8 cut(s) 110, 215, 393, 456, 483, 723, 747, 1300
DpnII GATC 8 cut(s) 108, 213, 391, 454, 481, 721, 745, 1298
DraI TTTAAA 1 cut(s) 648
Eam1104I CTCTTC 3 cut(s) 624, 672, 1222
EarI CTCTTC 3 cut(s) 624, 672, 1222
Eco130I CCWWGG 1 cut(s) 706
Eco147I AGGCCT 1 cut(s) 269
Eco47I GGWCC 2 cut(s) 253, 303
Eco57I CTGAAG 2 cut(s) 47, 653
EcoO109I RGGNCCY 1 cut(s) 303
EcoRI GAATTC 1 cut(s) 695
EcoRII CCWGG 2 cut(s) 1158, 1362
EcoT14I CCWWGG 1 cut(s) 706
ErhI CCWWGG 1 cut(s) 706
FaeI CATG 6 cut(s) 220, 365, 461, 695, 927, 1014
FalI AAGNNNNNCTT 2 cut(s) 290, 322
FaqI GGGAC 1 cut(s) 425
FatI CATG 6 cut(s) 216, 361, 457, 691, 923, 1010
FbaI TGATCA 2 cut(s) 213, 454
FblI GTMKAC 1 cut(s) 884
Fnu4HI GCNGC 9 cut(s) 7, 10, 13, 62, 427, 499, 1032, 1313, 1392
FokI GGATG 4 cut(s) 30, 107, 479, 1196
Fsp4HI GCNGC 9 cut(s) 7, 10, 13, 62, 427, 499, 1032, 1313, 1392
FspBI CTAG 2 cut(s) 812, 1064
GluI GCNGC 9 cut(s) 7, 10, 13, 62, 427, 499, 1032, 1313, 1392
GsaI CCCAGC 1 cut(s) 355
HaeIII GGCC 2 cut(s) 269, 768
HapII CCGG 2 cut(s) 179, 273
HgaI GACGC 2 cut(s) 498, 534
Hin1I GRCGYC 2 cut(s) 509, 545
Hin1II CATG 6 cut(s) 220, 365, 461, 695, 927, 1014
HinfI GANTC 7 cut(s) 39, 101, 673, 833, 1042, 1091, 1214
HpaII CCGG 2 cut(s) 179, 273
HphI GGTGA 1 cut(s) 867
Hpy166II GTNNAC 2 cut(s) 885, 1294
Hpy188I TCNGA 7 cut(s) 27, 52, 391, 445, 672, 793, 1021
Hpy188III TCNNGA 9 cut(s) 155, 179, 217, 236, 362, 458, 533, 830, 1046
Hpy8I GTNNAC 2 cut(s) 885, 1294
Hpy99I CGWCG 2 cut(s) 56, 550
HpyAV CCTTC 5 cut(s) 22, 322, 758, 957, 1199
HpyCH4III ACNGT 6 cut(s) 22, 257, 760, 1230, 1243, 1379
HpyCH4IV ACGT 1 cut(s) 322
HpyCH4V TGCA 8 cut(s) 96, 141, 260, 433, 501, 854, 1034, 1315
HpyF10VI GCNNNNNNNGC 4 cut(s) 12, 266, 498, 1318
HpyF3I CTNAG 4 cut(s) 65, 399, 656, 1145
HpySE526I ACGT 1 cut(s) 322
Hsp92I GRCGYC 2 cut(s) 509, 545
Hsp92II CATG 6 cut(s) 220, 365, 461, 695, 927, 1014
Kpn2I TCCGGA 1 cut(s) 178
Ksp22I TGATCA 2 cut(s) 213, 454
Kzo9I GATC 8 cut(s) 108, 213, 391, 454, 481, 721, 745, 1298
LguI GCTCTTC 1 cut(s) 672
LmnI GCTCC 6 cut(s) 58, 79, 281, 475, 652, 1067
Lsp1109I GCAGC 5 cut(s) 48, 413, 485, 1018, 1299
LweI GCATC 2 cut(s) 457, 652
MaeI CTAG 2 cut(s) 812, 1064
MaeII ACGT 1 cut(s) 322
MaeIII GTNAC 3 cut(s) 68, 1264, 1271
MalI GATC 8 cut(s) 110, 215, 393, 456, 483, 723, 747, 1300
MboI GATC 8 cut(s) 108, 213, 391, 454, 481, 721, 745, 1298
MluCI AATT 8 cut(s) 197, 538, 573, 695, 784, 992, 1085, 1168
MlyI GAGTC 2 cut(s) 95, 1208
MmeI TCCRAC 2 cut(s) 75, 1161
MroI TCCGGA 1 cut(s) 178
MroXI GAANNNNTTC 1 cut(s) 784
MseI TTAA 3 cut(s) 209, 647, 801
MslI CAYNNNNRTG 1 cut(s) 903
MspA1I CMGCKG 1 cut(s) 351
MspI CCGG 2 cut(s) 179, 273
MspR9I CCNGG 2 cut(s) 1160, 1364
MvaI CCWGG 2 cut(s) 1160, 1364
MvnI CGCG 2 cut(s) 156, 237
MwoI GCNNNNNNNGC 4 cut(s) 12, 266, 498, 1318
NdeII GATC 8 cut(s) 108, 213, 391, 454, 481, 721, 745, 1298
NlaIII CATG 6 cut(s) 220, 365, 461, 695, 927, 1014
NlaIV GGNNCC 2 cut(s) 183, 277
NmuCI GTSAC 3 cut(s) 68, 1264, 1271
NruI TCGCGA 2 cut(s) 156, 237
NspI RCATGY 2 cut(s) 927, 1014
NspV TTCGAA 1 cut(s) 699
PagI TCATGA 3 cut(s) 216, 361, 457
PceI AGGCCT 1 cut(s) 269
PciI ACATGT 2 cut(s) 923, 1010
PciSI GCTCTTC 1 cut(s) 672
PcsI WCGNNNNNNNCGW 1 cut(s) 153
PdmI GAANNNNTTC 1 cut(s) 784
PfeI GAWTC 5 cut(s) 39, 673, 833, 1042, 1091
PfoI TCCNGGA 1 cut(s) 1362
PkrI GCNGC 9 cut(s) 8, 11, 14, 63, 428, 500, 1033, 1314, 1393
Ple19I CGATCG 1 cut(s) 484
PleI GAGTC 2 cut(s) 95, 1208
PpsI GAGTC 2 cut(s) 95, 1208
PpuMI RGGWCCY 1 cut(s) 303
PscI ACATGT 2 cut(s) 923, 1010
PshBI ATTAAT 1 cut(s) 209
Psp5II RGGWCCY 1 cut(s) 303
Psp6I CCWGG 2 cut(s) 1158, 1362
PspFI CCCAGC 1 cut(s) 351
PspGI CCWGG 2 cut(s) 1158, 1362
PspN4I GGNNCC 2 cut(s) 183, 277
PspPI GGNCC 2 cut(s) 253, 303
PspPPI RGGWCCY 1 cut(s) 303
PstI CTGCAG 2 cut(s) 503, 1317
PstNI CAGNNNCTG 1 cut(s) 498
PvuI CGATCG 1 cut(s) 484
PvuII CAGCTG 1 cut(s) 351
RruI TCGCGA 2 cut(s) 156, 237
RsaI GTAC 4 cut(s) 437, 638, 1293, 1327
RsaNI GTAC 4 cut(s) 436, 637, 1292, 1326
RseI CAYNNNNRTG 1 cut(s) 903
SapI GCTCTTC 1 cut(s) 672
SaqAI TTAA 3 cut(s) 209, 647, 801
SatI GCNGC 9 cut(s) 7, 10, 13, 62, 427, 499, 1032, 1313, 1392
Sau3AI GATC 8 cut(s) 108, 213, 391, 454, 481, 721, 745, 1298
Sau96I GGNCC 2 cut(s) 253, 303
SchI GAGTC 2 cut(s) 95, 1208
ScrFI CCNGG 2 cut(s) 1160, 1364
SfaNI GCATC 2 cut(s) 457, 652
SfcI CTRYAG 3 cut(s) 499, 732, 1313
SfuI TTCGAA 1 cut(s) 699
SinI GGWCC 2 cut(s) 253, 303
SmiMI CAYNNNNRTG 1 cut(s) 903
SmlI CTYRAG 1 cut(s) 531
SmoI CTYRAG 1 cut(s) 531
Sse9I AATT 8 cut(s) 197, 538, 573, 695, 784, 992, 1085, 1168
SseBI AGGCCT 1 cut(s) 269
SsiI CCGC 3 cut(s) 9, 12, 689
SspI AATATT 1 cut(s) 967
SspMI CTAG 2 cut(s) 812, 1064
StuI AGGCCT 1 cut(s) 269
StyD4I CCNGG 2 cut(s) 1158, 1362
StyI CCWWGG 1 cut(s) 706
TaaI ACNGT 6 cut(s) 22, 257, 760, 1230, 1243, 1379
TaiI ACGT 1 cut(s) 325
TaqI TCGA 4 cut(s) 132, 484, 548, 699
TasI AATT 8 cut(s) 197, 538, 573, 695, 784, 992, 1085, 1168
TatI WGTACW 3 cut(s) 435, 1291, 1325
TauI GCSGC 2 cut(s) 12, 15
TfiI GAWTC 5 cut(s) 39, 673, 833, 1042, 1091
Tru1I TTAA 3 cut(s) 209, 647, 801
Tru9I TTAA 3 cut(s) 209, 647, 801
TscAI CASTG 4 cut(s) 586, 763, 1276, 1311
TseFI GTSAC 3 cut(s) 68, 1264, 1271
TseI GCWGC 7 cut(s) 6, 61, 426, 498, 1031, 1312, 1391
Tsp45I GTSAC 3 cut(s) 68, 1264, 1271
TspDTI ATGAA 8 cut(s) 350, 708, 777, 833, 921, 1083, 1162, 1188
TspGWI ACGGA 2 cut(s) 1152, 1311
TspRI CASTG 4 cut(s) 586, 763, 1276, 1311
VpaK11BI GGWCC 2 cut(s) 253, 303
VspI ATTAAT 1 cut(s) 209
XapI RAATTY 2 cut(s) 695, 1085
XceI RCATGY 2 cut(s) 927, 1014
XmiI GTMKAC 1 cut(s) 884
XmnI GAANNNNTTC 1 cut(s) 784
XspI CTAG 2 cut(s) 812, 1064
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.