Rroxscaffold_2G00088660

LysM domain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
10577809 .. 10578242
434 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00088660.1

Sequence Viewer

Length: 219 bp
ATGGCTAGGCCTAGCTTGATTCTACTTCTAGTTGTCTCTCTTCTTGTCATAATTTCAGTAGCTGAGAGTAAACGACTAGCTGAGGAAGGTGATACTTGCAGTCTTGTTGCTGAAATGTTCAACCTGAGTCTCGATTTCTTCCTTGCCATCAACCCTAATATCAATTGCGACAGCTTCTTTGTGGGTCAATGGCTTTGCGTTGATGGTGCTCAGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

7.89

Weight (kDa)

4.29

Isoelectric Point (pI)

35.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LysM PF01476 29 - 67 9.6e-07 LysM domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000334)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G28240
fragaria_vesca FvH4_3g03881 FvH4_3g03882 FvH4_3g39481 FvH4_3g39491 FvH4_4g25661 FvH4_5g02870 FvH4_5g34303 FvH4_5g34304 FvH4_6g24132 FvH4_6g44490 FvH4_6g44501 FvH4_6g44545 FvH4_6g44841
malus_domestica MD09G1090300.v1.1 MD09G1096600.v1.1 MD17G1084800.v1.1 MD17G1084900.v1.1
prunus_persica Prupe.1G064500_v2.0.a1 Prupe.3G230300_v2.0.a1 Prupe.3G230400_v2.0.a1 Prupe.3G230500_v2.0.a1 Prupe.3G230600_v2.0.a1 Prupe.3G230700_v2.0.a1 Prupe.3G230900_v2.0.a1 Prupe.4G037900_v2.0.a1
pyrus_communis pycom09g02100 pycom17g08220
rosa_chinensis RchiOBHm_Chr2g0161551 RchiOBHm_Chr2g0161661 RchiOBHm_Chr2g0161721 RchiOBHm_Chr2g0161751 RchiOBHm_Chr5g0006151 RchiOBHm_Chr5g0006161 RchiOBHm_Chr5g0071201 RchiOBHm_Chr7g0234891
rosa_laevigata RLG00000003965 RLG00000021291 RLG00000021295 RLG00000023183 RLG00000031379 RLG00000032398 RLG00000036195
rosa_multiflora Rmu_sc0000039.1_g000008 Rmu_sc0000637.1_g000006 Rmu_sc0007000.1_g000002 Rmu_sc0009339.1_g000009 Rmu_sc0027757.1_g000001 Rmu_sc0042097.1_g000001
rosa_roxburghii Rroxscaffold_1G00009880 Rroxscaffold_1G00069840 Rroxscaffold_1G00069850 Rroxscaffold_2G00088370 Rroxscaffold_2G00088630 Rroxscaffold_2G00088650 Rroxscaffold_2G00088660 Rroxscaffold_2G00088670 Rroxscaffold_2G00088680 Rroxscaffold_2G00088710 Rroxscaffold_3G00226660 Rroxscaffold_3G00226670 Rroxscaffold_3G00258720
rosa_rugosa Rorug02G0490500 Rorug02G0490600 Rorug02G0491600 Rorug02G0491800 Rorug02G0491800 Rorug02G0494100 Rorug05G0410900 Rorug07G0037000 Rorug07G0286000
rosa_samantha Rh2AG157300 Rh2AG556800 Rh2AG557500 Rh2AG557800 Rh2AG560100 Rh2BG163600 Rh2BG391200 Rh2BG570100 Rh2BG570600 Rh2BG571000 Rh2BG571100 Rh2BG571400 Rh2CG540600 Rh2CG541100 Rh2CG541400 Rh2CG541500 Rh2CG543700 Rh2DG162500 Rh2DG580000 Rh2DG580200 Rh2DG580300 Rh5AG047700 Rh5AG047800 Rh5BG046400 Rh5BG485500 Rh5CG055100 Rh5CG055200 Rh5CG510000 Rh5DG046200 Rh5DG496700 Rh7AG440700 Rh7AG468400 Rh7BG164100 Rh7BG413500 Rh7BG413600 Rh7CG170200 Rh7CG462400 Rh7CG462500 Rh7DG331400 Rh7DG430400
rosa_wichuraiana Rw2G046080

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 121
AluBI AGCT 4 cut(s) 15, 62, 80, 174
AluI AGCT 4 cut(s) 15, 62, 80, 174
Alw21I GWGCWC 1 cut(s) 211
Alw26I GTCTC 2 cut(s) 40, 134
AlwNI CAGNNNCTG 1 cut(s) 62
AoxI GGCC 1 cut(s) 8
ArsI GACNNNNNNTTYG 2 cut(s) 161, 193
AsuHPI GGTGA 1 cut(s) 101
Bbv12I GWGCWC 1 cut(s) 211
BbvCI CCTCAGC 1 cut(s) 81
BccI CCATC 2 cut(s) 155, 197
BcoDI GTCTC 2 cut(s) 40, 134
BfaI CTAG 4 cut(s) 6, 12, 29, 77
Bpu10I CCTNAGC 1 cut(s) 81
BseMII CTCAG 3 cut(s) 54, 72, 116
BshFI GGCC 1 cut(s) 10
BsiHKAI GWGCWC 1 cut(s) 211
BsmAI GTCTC 2 cut(s) 40, 134
BsnI GGCC 1 cut(s) 10
Bsp1286I GDGCHC 1 cut(s) 211
BspANI GGCC 1 cut(s) 10
BspCNI CTCAG 3 cut(s) 55, 73, 117
Bst6I CTCTTC 1 cut(s) 45
BstDEI CTNAG 4 cut(s) 63, 81, 125, 210
BstMAI GTCTC 2 cut(s) 40, 134
BsuRI GGCC 1 cut(s) 10
CaiI CAGNNNCTG 1 cut(s) 62
CviJI RGCY 7 cut(s) 5, 10, 15, 62, 80, 174, 193
CviKI_1 RGCY 7 cut(s) 5, 10, 15, 62, 80, 174, 193
DdeI CTNAG 4 cut(s) 63, 81, 125, 210
Eam1104I CTCTTC 1 cut(s) 45
EarI CTCTTC 1 cut(s) 45
Eco147I AGGCCT 1 cut(s) 10
FaiI YATR 1 cut(s) 50
FspBI CTAG 4 cut(s) 6, 12, 29, 77
HaeIII GGCC 1 cut(s) 10
HinfI GANTC 2 cut(s) 19, 127
HphI GGTGA 1 cut(s) 101
Hpy166II GTNNAC 1 cut(s) 71
Hpy188I TCNGA 1 cut(s) 213
Hpy188III TCNNGA 1 cut(s) 131
Hpy8I GTNNAC 1 cut(s) 71
HpyAV CCTTC 1 cut(s) 80
HpyCH4V TGCA 1 cut(s) 99
HpyF3I CTNAG 4 cut(s) 63, 81, 125, 210
LpnPI CCDG 1 cut(s) 137
MaeI CTAG 4 cut(s) 6, 12, 29, 77
MboII GAAGA 2 cut(s) 32, 130
MfeI CAATTG 1 cut(s) 163
MhlI GDGCHC 1 cut(s) 211
MluCI AATT 2 cut(s) 51, 163
MlyI GAGTC 1 cut(s) 136
MnlI CCTC 1 cut(s) 76
MunI CAATTG 1 cut(s) 163
PceI AGGCCT 1 cut(s) 10
PfeI GAWTC 1 cut(s) 19
PleI GAGTC 1 cut(s) 135
PpsI GAGTC 1 cut(s) 135
PstNI CAGNNNCTG 1 cut(s) 62
SchI GAGTC 1 cut(s) 136
SduI GDGCHC 1 cut(s) 211
SetI ASST 6 cut(s) 17, 64, 82, 91, 126, 176
Sse9I AATT 2 cut(s) 51, 163
SseBI AGGCCT 1 cut(s) 10
SspMI CTAG 4 cut(s) 6, 12, 29, 77
StuI AGGCCT 1 cut(s) 10
TaqI TCGA 1 cut(s) 132
TasI AATT 2 cut(s) 51, 163
TfiI GAWTC 1 cut(s) 19
XspI CTAG 4 cut(s) 6, 12, 29, 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.