Rh5DG142400

Belongs to the iron ascorbate-dependent oxidoreductase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
14563830 .. 14564132
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG142400.1

Sequence Viewer

Length: 303 bp
ATGGATATGGAGGCAATTCATGATGAAGAAGTAATCCCAACTCTTGAATTTTCTAGTGTGTTTTTAGTCTCAAAGCAAGGGAGTGAGGAATGGAAAGCTATGAGGAACAAAGTGAGAGAGGCATGTCAGAGTTATGGTTGCTTTCTGCTGTTGGTGCGGGAAGAGACAATCCCCATCAACTTACGTGAAGAAATGGTGATGGCCATGAAGGGTTTGTTGATCTCCCTGAAGAGACCAAGCAGAACACAAAAATACGAACCTCTTTCCTTGACTACCAAGGCAAATCCCCCAACTTTCCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.55

Weight (kDa)

6.12

Isoelectric Point (pI)

51.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 157
AcoI YGGCCR 1 cut(s) 201
AcsI RAATTY 1 cut(s) 47
AcuI CTGAAG 1 cut(s) 248
AgsI TTSAA 1 cut(s) 47
AluBI AGCT 1 cut(s) 98
AluI AGCT 1 cut(s) 98
Alw26I GTCTC 3 cut(s) 73, 158, 226
AoxI GGCC 1 cut(s) 201
ApoI RAATTY 1 cut(s) 47
AsuHPI GGTGA 1 cut(s) 208
BalI TGGCCA 1 cut(s) 203
BccI CCATC 2 cut(s) 182, 193
BcoDI GTCTC 3 cut(s) 73, 158, 226
BfaI CTAG 1 cut(s) 54
BsaAI YACGTR 1 cut(s) 185
BsaI GGTCTC 1 cut(s) 226
BsaJI CCNNGG 1 cut(s) 276
BseDI CCNNGG 1 cut(s) 276
BshFI GGCC 1 cut(s) 203
BsmAI GTCTC 3 cut(s) 73, 158, 226
BsnI GGCC 1 cut(s) 203
Bso31I GGTCTC 1 cut(s) 226
Bsp143I GATC 1 cut(s) 219
BspACI CCGC 1 cut(s) 157
BspANI GGCC 1 cut(s) 203
BspHI TCATGA 1 cut(s) 19
BspTNI GGTCTC 1 cut(s) 226
BssECI CCNNGG 1 cut(s) 276
BssMI GATC 1 cut(s) 219
BssT1I CCWWGG 1 cut(s) 276
Bst6I CTCTTC 2 cut(s) 156, 224
BstBAI YACGTR 1 cut(s) 185
BstKTI GATC 1 cut(s) 222
BstMAI GTCTC 3 cut(s) 73, 158, 226
BstMBI GATC 1 cut(s) 219
BstMWI GCNNNNNNNGC 1 cut(s) 154
BstNSI RCATGY 1 cut(s) 126
BsuRI GGCC 1 cut(s) 203
CciI TCATGA 1 cut(s) 19
CviAII CATG 3 cut(s) 20, 123, 205
CviJI RGCY 2 cut(s) 98, 203
CviKI_1 RGCY 2 cut(s) 98, 203
DpnI GATC 1 cut(s) 221
DpnII GATC 1 cut(s) 219
EaeI YGGCCR 1 cut(s) 201
Eam1104I CTCTTC 2 cut(s) 156, 224
EarI CTCTTC 2 cut(s) 156, 224
Eco130I CCWWGG 1 cut(s) 276
Eco31I GGTCTC 1 cut(s) 226
Eco57I CTGAAG 1 cut(s) 248
EcoT14I CCWWGG 1 cut(s) 276
ErhI CCWWGG 1 cut(s) 276
FaeI CATG 3 cut(s) 23, 126, 208
FaiI YATR 6 cut(s) 8, 21, 101, 124, 135, 206
FatI CATG 3 cut(s) 19, 122, 204
FauI CCCGC 1 cut(s) 150
FspBI CTAG 1 cut(s) 54
HaeIII GGCC 1 cut(s) 203
Hin1II CATG 3 cut(s) 23, 126, 208
HphI GGTGA 1 cut(s) 208
Hpy188I TCNGA 1 cut(s) 129
Hpy188III TCNNGA 2 cut(s) 20, 44
HpyAV CCTTC 1 cut(s) 202
HpyCH4IV ACGT 1 cut(s) 184
HpyF10VI GCNNNNNNNGC 1 cut(s) 154
HpySE526I ACGT 1 cut(s) 184
Hsp92II CATG 3 cut(s) 23, 126, 208
Kzo9I GATC 1 cut(s) 219
LpnPI CCDG 1 cut(s) 239
MaeI CTAG 1 cut(s) 54
MaeII ACGT 1 cut(s) 184
MalI GATC 1 cut(s) 221
MboI GATC 1 cut(s) 219
MboII GAAGA 4 cut(s) 38, 173, 200, 241
MlsI TGGCCA 1 cut(s) 203
MluCI AATT 2 cut(s) 15, 47
MluNI TGGCCA 1 cut(s) 203
MnlI CCTC 5 cut(s) 4, 79, 96, 112, 270
Mox20I TGGCCA 1 cut(s) 203
MscI TGGCCA 1 cut(s) 203
Msp20I TGGCCA 1 cut(s) 203
MwoI GCNNNNNNNGC 1 cut(s) 154
NdeII GATC 1 cut(s) 219
NlaIII CATG 3 cut(s) 23, 126, 208
NspI RCATGY 1 cut(s) 126
PagI TCATGA 1 cut(s) 19
Ppu21I YACGTR 1 cut(s) 185
Sau3AI GATC 1 cut(s) 219
SetI ASST 3 cut(s) 100, 187, 262
Sse9I AATT 2 cut(s) 15, 47
SsiI CCGC 1 cut(s) 157
SspMI CTAG 1 cut(s) 54
StyI CCWWGG 1 cut(s) 276
TaiI ACGT 1 cut(s) 187
TasI AATT 2 cut(s) 15, 47
TspDTI ATGAA 3 cut(s) 8, 39, 221
XapI RAATTY 1 cut(s) 47
XceI RCATGY 1 cut(s) 126
XspI CTAG 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.