FvH4_1g24841

gag-polypeptide of LTR copia-type

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
OG0000703
Physical Location & Seq
Forward (+)
16622457 .. 16623949
1493 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g24841.t1

Sequence Viewer

Length: 471 bp
ATGGAACGTGATTCACATAGCTCGGCAGTTAACACTCCTCCATGGTTTGATGGTGAAAATTATTTGGATTGGAAGATTATGATGCAATCGTTCATGTACGCTCAAGATGAACTCTGCTGGGCCATGAAGTCTACTTGGAGTGACAGCGATGATGAACCTCAATCAACTAGGAAACACTTTGCTCTAATATCCTCTTTCCATGAAGATGAATCAGATGTTGATCTTGAAAGTTCTGATGATGAAGATGATCTTATCTCTTATGAAGCCAATGATATGTACACAAAATTGTACAATGCCACAATGAAGGATGGAGCATCATTACAGGTCACTCAAGAAGATGGTGGTGAAAAGGATGACAAAATCAAAACCTTACAGGTAGAATTAAAGGGCCAAATTCTTCTAAATGTGGAATTAACTTGTAAAAATGAAAAATTGCAGGCCGAAGTGATGAAAGCTCATGAGCGTTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4219 Retrotran_gag_2

Protein Analysis

157

Amino Acids

18.05

Weight (kDa)

4.31

Isoelectric Point (pI)

34.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 131
AcsI RAATTY 1 cut(s) 393
AfaI GTAC 3 cut(s) 98, 278, 290
AgsI TTSAA 1 cut(s) 227
AluBI AGCT 2 cut(s) 21, 455
AluI AGCT 2 cut(s) 21, 455
AoxI GGCC 3 cut(s) 120, 388, 438
ApoI RAATTY 1 cut(s) 393
AspS9I GGNCC 2 cut(s) 120, 388
AsuHPI GGTGA 2 cut(s) 65, 356
BccI CCATC 3 cut(s) 44, 302, 332
BfaI CTAG 1 cut(s) 168
BmgT120I GGNCC 2 cut(s) 120, 388
BmsI GCATC 2 cut(s) 72, 323
BpuEI CTTGAG 2 cut(s) 87, 315
BsaBI GATNNNNATC 1 cut(s) 219
BsaJI CCNNGG 1 cut(s) 41
Bse8I GATNNNNATC 1 cut(s) 219
BseDI CCNNGG 1 cut(s) 41
BseGI GGATG 2 cut(s) 313, 358
BseJI GATNNNNATC 1 cut(s) 219
BseRI GAGGAG 1 cut(s) 27
BseYI CCCAGC 1 cut(s) 117
BshFI GGCC 3 cut(s) 122, 390, 440
BsnI GGCC 3 cut(s) 122, 390, 440
Bsp1407I TGTACA 2 cut(s) 276, 288
Bsp143I GATC 2 cut(s) 220, 247
Bsp19I CCATGG 1 cut(s) 41
BspANI GGCC 3 cut(s) 122, 390, 440
BspHI TCATGA 1 cut(s) 457
BsrGI TGTACA 2 cut(s) 276, 288
BssECI CCNNGG 1 cut(s) 41
BssMI GATC 2 cut(s) 220, 247
BssT1I CCWWGG 1 cut(s) 41
BstAUI TGTACA 2 cut(s) 276, 288
BstC8I GCNNGC 1 cut(s) 438
BstDSI CCRYGG 1 cut(s) 41
BstF5I GGATG 2 cut(s) 313, 358
BstKTI GATC 2 cut(s) 223, 250
BstMBI GATC 2 cut(s) 220, 247
BsuRI GGCC 3 cut(s) 122, 390, 440
BtgI CCRYGG 1 cut(s) 41
BtgZI GCGATG 1 cut(s) 162
BtsCI GGATG 2 cut(s) 313, 358
Cac8I GCNNGC 1 cut(s) 438
CciI TCATGA 1 cut(s) 457
Cfr13I GGNCC 2 cut(s) 120, 388
Csp6I GTAC 3 cut(s) 97, 277, 289
CviAII CATG 5 cut(s) 42, 94, 124, 200, 458
CviJI RGCY 6 cut(s) 21, 122, 266, 390, 440, 455
CviKI_1 RGCY 6 cut(s) 21, 122, 266, 390, 440, 455
CviQI GTAC 3 cut(s) 97, 277, 289
DpnI GATC 2 cut(s) 222, 249
DpnII GATC 2 cut(s) 220, 247
Eco130I CCWWGG 1 cut(s) 41
EcoT14I CCWWGG 1 cut(s) 41
ErhI CCWWGG 1 cut(s) 41
FaeI CATG 5 cut(s) 45, 97, 127, 203, 461
FaiI YATR 9 cut(s) 18, 43, 80, 95, 125, 201, 261, 275, 459
FalI AAGNNNNNCTT 2 cut(s) 234, 266
FatI CATG 5 cut(s) 41, 93, 123, 199, 457
FblI GTMKAC 1 cut(s) 131
FokI GGATG 2 cut(s) 320, 365
FspBI CTAG 1 cut(s) 168
GsaI CCCAGC 1 cut(s) 121
HaeIII GGCC 3 cut(s) 122, 390, 440
Hin1II CATG 5 cut(s) 45, 97, 127, 203, 461
HincII GTYRAC 1 cut(s) 31
HindII GTYRAC 1 cut(s) 31
HinfI GANTC 2 cut(s) 11, 209
HpaI GTTAAC 1 cut(s) 31
HphI GGTGA 2 cut(s) 65, 356
Hpy166II GTNNAC 3 cut(s) 31, 132, 279
Hpy188I TCNGA 2 cut(s) 214, 235
Hpy188III TCNNGA 4 cut(s) 104, 224, 332, 458
Hpy8I GTNNAC 3 cut(s) 31, 132, 279
HpyAV CCTTC 1 cut(s) 298
HpyCH4IV ACGT 1 cut(s) 7
HpyCH4V TGCA 2 cut(s) 85, 436
HpySE526I ACGT 1 cut(s) 7
Hsp92II CATG 5 cut(s) 45, 97, 127, 203, 461
KspAI GTTAAC 1 cut(s) 31
Kzo9I GATC 2 cut(s) 220, 247
LmnI GCTCC 1 cut(s) 311
LpnPI CCDG 4 cut(s) 103, 308, 359, 422
LweI GCATC 2 cut(s) 72, 323
MaeI CTAG 1 cut(s) 168
MaeII ACGT 1 cut(s) 7
MaeIII GTNAC 2 cut(s) 140, 325
MalI GATC 2 cut(s) 222, 249
MboI GATC 2 cut(s) 220, 247
MboII GAAGA 5 cut(s) 85, 215, 254, 347, 389
MluCI AATT 6 cut(s) 58, 284, 380, 393, 410, 431
MnlI CCTC 3 cut(s) 48, 168, 202
MseI TTAA 4 cut(s) 30, 383, 413, 469
MslI CAYNNNNRTG 1 cut(s) 204
NcoI CCATGG 1 cut(s) 41
NdeII GATC 2 cut(s) 220, 247
NlaIII CATG 5 cut(s) 45, 97, 127, 203, 461
NmuCI GTSAC 2 cut(s) 140, 325
PagI TCATGA 1 cut(s) 457
PfeI GAWTC 2 cut(s) 11, 209
PspFI CCCAGC 1 cut(s) 117
PspPI GGNCC 2 cut(s) 120, 388
RsaI GTAC 3 cut(s) 98, 278, 290
RsaNI GTAC 3 cut(s) 97, 277, 289
RseI CAYNNNNRTG 1 cut(s) 204
SaqAI TTAA 4 cut(s) 30, 383, 413, 469
Sau3AI GATC 2 cut(s) 220, 247
Sau96I GGNCC 2 cut(s) 120, 388
SetI ASST 7 cut(s) 10, 23, 160, 327, 371, 378, 457
SfaNI GCATC 2 cut(s) 72, 323
SmiMI CAYNNNNRTG 1 cut(s) 204
SmlI CTYRAG 2 cut(s) 102, 330
SmoI CTYRAG 2 cut(s) 102, 330
Sse9I AATT 6 cut(s) 58, 284, 380, 393, 410, 431
SspMI CTAG 1 cut(s) 168
StyI CCWWGG 1 cut(s) 41
TaiI ACGT 1 cut(s) 10
TasI AATT 6 cut(s) 58, 284, 380, 393, 410, 431
TatI WGTACW 2 cut(s) 276, 288
TfiI GAWTC 2 cut(s) 11, 209
Tru1I TTAA 4 cut(s) 30, 383, 413, 469
Tru9I TTAA 4 cut(s) 30, 383, 413, 469
TseFI GTSAC 2 cut(s) 140, 325
Tsp45I GTSAC 2 cut(s) 140, 325
XapI RAATTY 1 cut(s) 393
XmiI GTMKAC 1 cut(s) 131
XspI CTAG 1 cut(s) 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.