Rmu_sc0005071.1_g000010

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005071.1
OG0000703
Physical Location & Seq
Forward (+)
53971 .. 54246
276 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005071.1_g000010.1.cds

Sequence Viewer

Length: 276 bp
atggcttctaagtcaacttggagtgacagtgaggaagattctcaaactgaaaatgaagaagagaatactgctttcaccttctcacttcgtcatgaggcatctgacgatttcgacactaaaggtgagatttttgatgtatctaatggggaaactaatgataagtgcagggaattgtataaagcttcaagagtgatgctcaaaagaaatctcaagctggagaacgagattgagcacattagagacttgaaaaaaaaatcctcaaaaagggattattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.68

Weight (kDa)

4.95

Isoelectric Point (pI)

53.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 264
AgsI TTSAA 2 cut(s) 186, 247
AluBI AGCT 2 cut(s) 182, 214
AluI AGCT 2 cut(s) 182, 214
Alw21I GWGCWC 1 cut(s) 234
Alw26I GTCTC 1 cut(s) 234
AsuHPI GGTGA 2 cut(s) 67, 134
Bbv12I GWGCWC 1 cut(s) 234
BcoDI GTCTC 1 cut(s) 234
BmsI GCATC 2 cut(s) 107, 183
BplI GAGNNNNNCTC 2 cut(s) 180, 212
BpmI CTGGAG 1 cut(s) 236
BpuEI CTTGAG 1 cut(s) 194
BsaXI ACNNNNNCTCC 2 cut(s) 13, 43
Bsc4I CCNNNNNNNGG 1 cut(s) 264
BseLI CCNNNNNNNGG 1 cut(s) 264
BsgI GTGCAG 1 cut(s) 184
BsiHKAI GWGCWC 1 cut(s) 234
BslI CCNNNNNNNGG 1 cut(s) 264
BsmAI GTCTC 1 cut(s) 234
Bsp1286I GDGCHC 1 cut(s) 234
BspHI TCATGA 1 cut(s) 91
Bst4CI ACNGT 1 cut(s) 29
Bst6I CTCTTC 1 cut(s) 54
BstDEI CTNAG 1 cut(s) 9
BstENI CCTNNNNNAGG 1 cut(s) 262
BstMAI GTCTC 1 cut(s) 234
BtsIMutI CAGTG 1 cut(s) 34
CciI TCATGA 1 cut(s) 91
CviAII CATG 1 cut(s) 92
CviJI RGCY 3 cut(s) 5, 182, 214
CviKI_1 RGCY 3 cut(s) 5, 182, 214
DdeI CTNAG 1 cut(s) 9
Eam1104I CTCTTC 1 cut(s) 54
EarI CTCTTC 1 cut(s) 54
EcoNI CCTNNNNNAGG 1 cut(s) 262
FaeI CATG 1 cut(s) 95
FaiI YATR 2 cut(s) 93, 177
FatI CATG 1 cut(s) 91
GsuI CTGGAG 1 cut(s) 236
Hin1II CATG 1 cut(s) 95
HincII GTYRAC 1 cut(s) 15
HindII GTYRAC 1 cut(s) 15
HindIII AAGCTT 1 cut(s) 180
HinfI GANTC 1 cut(s) 38
HphI GGTGA 2 cut(s) 67, 134
Hpy166II GTNNAC 1 cut(s) 15
Hpy188I TCNGA 1 cut(s) 103
Hpy188III TCNNGA 2 cut(s) 92, 186
Hpy8I GTNNAC 1 cut(s) 15
HpyAV CCTTC 1 cut(s) 88
HpyCH4III ACNGT 1 cut(s) 29
HpyCH4V TGCA 1 cut(s) 165
HpyF3I CTNAG 1 cut(s) 9
Hsp92II CATG 1 cut(s) 95
LpnPI CCDG 2 cut(s) 151, 200
LweI GCATC 2 cut(s) 107, 183
MaeIII GTNAC 1 cut(s) 23
MboII GAAGA 3 cut(s) 47, 68, 71
MhlI GDGCHC 1 cut(s) 234
MluCI AATT 1 cut(s) 170
MnlI CCTC 3 cut(s) 25, 88, 268
NlaIII CATG 1 cut(s) 95
NmuCI GTSAC 1 cut(s) 23
PagI TCATGA 1 cut(s) 91
PfeI GAWTC 1 cut(s) 38
SduI GDGCHC 1 cut(s) 234
SetI ASST 4 cut(s) 80, 124, 184, 216
SfaNI GCATC 2 cut(s) 107, 183
SgeI CNNG 8 cut(s) 30, 104, 178, 198, 223, 227, 235, 256
SmlI CTYRAG 1 cut(s) 209
SmoI CTYRAG 1 cut(s) 209
Sse9I AATT 1 cut(s) 170
TaaI ACNGT 1 cut(s) 29
TaqI TCGA 1 cut(s) 111
TasI AATT 1 cut(s) 170
TfiI GAWTC 1 cut(s) 38
TscAI CASTG 1 cut(s) 34
TseFI GTSAC 1 cut(s) 23
Tsp45I GTSAC 1 cut(s) 23
TspDTI ATGAA 1 cut(s) 69
TspRI CASTG 1 cut(s) 34
XagI CCTNNNNNAGG 1 cut(s) 262
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.