Rmu_sc0003339.1_g000002

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003339.1
OG0000703
Physical Location & Seq
Reverse (-)
14258 .. 16767
2510 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003339.1_g000002.1.cds

Sequence Viewer

Length: 489 bp
atgttggagacttcacaatccacatgggaacaggaaagaagcaatcttgttactgagatggctatctcgtcaagtgatcagggctcgtcaagttggaaggctaaaaaggctgaatatctcaacaaaatcaaaatgctggaactggatgtgaggggacaacaagttctaaatctggagttattggctaaaattgagtccctacaagatgagctaaaatcgactcaagaaaaattcaccagatttgaggaaatcccgatttgctacagtgaccgtcctcttcttctcgttgctgcaccttccacagttcatattaagctacgaaacgaacccaaaaatgaagagaaggaagagagctttccaacgacatcttatacgtcaaaatccgtcgccggatggaggagttatggccggaagaaggtgaagaggtcggagaggaagagagaatcggggagagagaagggaaatggctcggtaagtttccgaaaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

162

Amino Acids

18.63

Weight (kDa)

9.38

Isoelectric Point (pI)

59.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 406
AcsI RAATTY 1 cut(s) 230
AfiI CCNNNNNNNGG 2 cut(s) 396, 415
AloI GAACNNNNNNTCC 2 cut(s) 147, 179
AluBI AGCT 3 cut(s) 211, 316, 354
AluI AGCT 3 cut(s) 211, 316, 354
Alw26I GTCTC 1 cut(s) 2
AoxI GGCC 1 cut(s) 406
ApeKI GCWGC 1 cut(s) 290
ApoI RAATTY 1 cut(s) 230
AsuHPI GGTGA 2 cut(s) 226, 430
BanII GRGCYC 1 cut(s) 86
BbvI GCAGC 1 cut(s) 277
BccI CCATC 2 cut(s) 52, 387
BclI TGATCA 1 cut(s) 76
BcoDI GTCTC 1 cut(s) 2
BfmI CTRYAG 1 cut(s) 262
BisI GCNGC 1 cut(s) 291
BlsI GCNGC 1 cut(s) 292
BpmI CTGGAG 1 cut(s) 194
BpuEI CTTGAG 1 cut(s) 207
BsaBI GATNNNNATC 1 cut(s) 62
Bsc4I CCNNNNNNNGG 2 cut(s) 396, 415
Bse1I ACTGG 1 cut(s) 147
Bse8I GATNNNNATC 1 cut(s) 62
BseGI GGATG 2 cut(s) 151, 398
BseJI GATNNNNATC 1 cut(s) 62
BseLI CCNNNNNNNGG 2 cut(s) 396, 415
BseMII CTCAG 1 cut(s) 45
BseNI ACTGG 1 cut(s) 147
BseRI GAGGAG 1 cut(s) 412
BseXI GCAGC 1 cut(s) 277
BsgI GTGCAG 1 cut(s) 276
BshFI GGCC 1 cut(s) 408
BsiSI CCGG 2 cut(s) 390, 409
BslFI GGGAC 2 cut(s) 168, 181
BslI CCNNNNNNNGG 2 cut(s) 396, 415
BsmAI GTCTC 1 cut(s) 2
BsmFI GGGAC 2 cut(s) 168, 181
BsnI GGCC 1 cut(s) 408
Bsp1286I GDGCHC 1 cut(s) 86
Bsp143I GATC 1 cut(s) 76
BspANI GGCC 1 cut(s) 408
BspCNI CTCAG 1 cut(s) 46
BsrI ACTGG 1 cut(s) 147
BssMI GATC 1 cut(s) 76
Bst4CI ACNGT 3 cut(s) 266, 272, 304
Bst6I CTCTTC 5 cut(s) 282, 333, 342, 416, 431
BstDEI CTNAG 1 cut(s) 54
BstF5I GGATG 2 cut(s) 151, 398
BstKTI GATC 1 cut(s) 79
BstMAI GTCTC 1 cut(s) 2
BstMBI GATC 1 cut(s) 76
BstMWI GCNNNNNNNGC 1 cut(s) 107
BstSFI CTRYAG 1 cut(s) 262
BstV1I GCAGC 1 cut(s) 277
BsuRI GGCC 1 cut(s) 408
BtsCI GGATG 2 cut(s) 151, 398
BtsIMutI CAGTG 1 cut(s) 271
CviAII CATG 1 cut(s) 24
DdeI CTNAG 1 cut(s) 54
DpnI GATC 1 cut(s) 78
DpnII GATC 1 cut(s) 76
EaeI YGGCCR 1 cut(s) 406
Eam1104I CTCTTC 5 cut(s) 282, 333, 342, 416, 431
EarI CTCTTC 5 cut(s) 282, 333, 342, 416, 431
Eco24I GRGCYC 1 cut(s) 86
EcoT38I GRGCYC 1 cut(s) 86
FaeI CATG 1 cut(s) 27
FaiI YATR 4 cut(s) 25, 309, 372, 405
FaqI GGGAC 2 cut(s) 168, 181
FatI CATG 1 cut(s) 23
FbaI TGATCA 1 cut(s) 76
Fnu4HI GCNGC 1 cut(s) 291
FokI GGATG 2 cut(s) 158, 405
FriOI GRGCYC 1 cut(s) 86
Fsp4HI GCNGC 1 cut(s) 291
GluI GCNGC 1 cut(s) 291
GsuI CTGGAG 1 cut(s) 194
HaeIII GGCC 1 cut(s) 408
HapII CCGG 2 cut(s) 390, 409
Hin1II CATG 1 cut(s) 27
HinfI GANTC 3 cut(s) 194, 220, 443
HpaII CCGG 2 cut(s) 390, 409
HphI GGTGA 2 cut(s) 226, 430
Hpy188I TCNGA 2 cut(s) 430, 482
Hpy188III TCNNGA 3 cut(s) 173, 224, 253
Hpy99I CGWCG 1 cut(s) 389
HpyAV CCTTC 5 cut(s) 91, 306, 337, 409, 451
HpyCH4III ACNGT 3 cut(s) 266, 272, 304
HpyCH4IV ACGT 1 cut(s) 374
HpyCH4V TGCA 1 cut(s) 293
HpyF10VI GCNNNNNNNGC 1 cut(s) 107
HpyF3I CTNAG 1 cut(s) 54
HpySE526I ACGT 1 cut(s) 374
Hsp92II CATG 1 cut(s) 27
Ksp22I TGATCA 1 cut(s) 76
Kzo9I GATC 1 cut(s) 76
LpnPI CCDG 8 cut(s) 17, 65, 122, 128, 158, 250, 403, 422
Lsp1109I GCAGC 1 cut(s) 277
MaeII ACGT 1 cut(s) 374
MaeIII GTNAC 2 cut(s) 49, 266
MalI GATC 1 cut(s) 78
MboI GATC 1 cut(s) 76
MboII GAAGA 7 cut(s) 269, 272, 350, 359, 424, 433, 448
MhlI GDGCHC 1 cut(s) 86
MluCI AATT 2 cut(s) 189, 230
MlyI GAGTC 2 cut(s) 203, 214
MmeI TCCRAC 3 cut(s) 74, 383, 408
MnlI CCTC 6 cut(s) 144, 238, 285, 390, 417, 426
MseI TTAA 1 cut(s) 312
MspI CCGG 2 cut(s) 390, 409
MwoI GCNNNNNNNGC 1 cut(s) 107
NdeII GATC 1 cut(s) 76
NlaIII CATG 1 cut(s) 27
NmuCI GTSAC 1 cut(s) 266
PfeI GAWTC 1 cut(s) 443
PkrI GCNGC 1 cut(s) 292
PleI GAGTC 2 cut(s) 202, 214
PpsI GAGTC 2 cut(s) 202, 214
SaqAI TTAA 1 cut(s) 312
SatI GCNGC 1 cut(s) 291
Sau3AI GATC 1 cut(s) 76
SchI GAGTC 2 cut(s) 203, 214
SduI GDGCHC 1 cut(s) 86
SetI ASST 7 cut(s) 213, 298, 318, 356, 377, 420, 428
SfcI CTRYAG 1 cut(s) 262
SmlI CTYRAG 1 cut(s) 222
SmoI CTYRAG 1 cut(s) 222
Sse9I AATT 2 cut(s) 189, 230
TaaI ACNGT 3 cut(s) 266, 272, 304
TaiI ACGT 1 cut(s) 377
TaqI TCGA 1 cut(s) 218
TasI AATT 2 cut(s) 189, 230
TfiI GAWTC 1 cut(s) 443
Tru1I TTAA 1 cut(s) 312
Tru9I TTAA 1 cut(s) 312
TscAI CASTG 1 cut(s) 271
TseFI GTSAC 1 cut(s) 266
TseI GCWGC 1 cut(s) 290
Tsp45I GTSAC 1 cut(s) 266
TspDTI ATGAA 2 cut(s) 296, 351
TspGWI ACGGA 1 cut(s) 373
TspRI CASTG 1 cut(s) 271
XapI RAATTY 1 cut(s) 230
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.