Rmu_sc0000721.1_g000029

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000721.1
Physical Location & Seq
Reverse (-)
93461 .. 93964
504 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000721.1_g000029.1.cds

Sequence Viewer

Length: 504 bp
atggagggtgatagtgatgaagaggtaaatcttgctcttacttcctcttttaattccgatttatctgatgtttctgatttagaagatgacacttctgatgaagaaacaaatgaaaaatgcaagcaattgtataatgcctcaagaattgttcttaagaaaaataataaacttgaagaggaaattgaattcttacggggtgagaaagaaaagattgagaaaagatttgaaatatctttgaaagaatgggaagatgagcgtactgaccttgttgctaagataaatgttttgcaggttgaagttaaggctcaatcttccttaaatgtgtctctaacccttgagaatgagaaattgcaggaagaattattaagggtcaaggaaagctttaacaaattctccattggatctgaaaaagtctctaagatgatgggaattggcaaagctcatggcaataaagaaggattaggatataatggtgaatcccatgcaaaccattggcttttgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

167

Amino Acids

19.05

Weight (kDa)

4.73

Isoelectric Point (pI)

44.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 280
AclWI GGATC 1 cut(s) 409
AcsI RAATTY 2 cut(s) 185, 389
AfaI GTAC 1 cut(s) 259
AflII CTTAAG 1 cut(s) 152
AgsI TTSAA 5 cut(s) 173, 185, 227, 238, 296
AluBI AGCT 2 cut(s) 381, 440
AluI AGCT 2 cut(s) 381, 440
Alw26I GTCTC 2 cut(s) 330, 418
AlwI GGATC 1 cut(s) 409
ApoI RAATTY 2 cut(s) 185, 389
AsuHPI GGTGA 3 cut(s) 20, 209, 485
BccI CCATC 1 cut(s) 418
BcoDI GTCTC 2 cut(s) 330, 418
BfrI CTTAAG 1 cut(s) 152
BfuAI ACCTGC 1 cut(s) 280
BpuEI CTTGAG 2 cut(s) 124, 356
BsaXI ACNNNNNCTCC 2 cut(s) 377, 407
BsmAI GTCTC 2 cut(s) 330, 418
Bsp143I GATC 1 cut(s) 401
BspMI ACCTGC 1 cut(s) 280
BspPI GGATC 1 cut(s) 409
BspTI CTTAAG 1 cut(s) 152
BssMI GATC 1 cut(s) 401
Bst6I CTCTTC 2 cut(s) 15, 168
BstAFI CTTAAG 1 cut(s) 152
BstC8I GCNNGC 1 cut(s) 122
BstDEI CTNAG 2 cut(s) 273, 417
BstKTI GATC 1 cut(s) 404
BstMAI GTCTC 2 cut(s) 330, 418
BstMBI GATC 1 cut(s) 401
BstX2I RGATCY 1 cut(s) 401
BstYI RGATCY 1 cut(s) 401
BveI ACCTGC 1 cut(s) 280
Cac8I GCNNGC 1 cut(s) 122
Csp6I GTAC 1 cut(s) 258
CviAII CATG 2 cut(s) 443, 482
CviJI RGCY 4 cut(s) 305, 381, 440, 496
CviKI_1 RGCY 4 cut(s) 305, 381, 440, 496
CviQI GTAC 1 cut(s) 258
DdeI CTNAG 2 cut(s) 273, 417
DpnI GATC 1 cut(s) 403
DpnII GATC 1 cut(s) 401
Eam1104I CTCTTC 2 cut(s) 15, 168
EarI CTCTTC 2 cut(s) 15, 168
EcoRI GAATTC 1 cut(s) 185
FaeI CATG 2 cut(s) 446, 485
FaiI YATR 4 cut(s) 132, 444, 468, 483
FalI AAGNNNNNCTT 2 cut(s) 365, 397
FatI CATG 2 cut(s) 442, 481
Hin1II CATG 2 cut(s) 446, 485
HindIII AAGCTT 1 cut(s) 379
HinfI GANTC 1 cut(s) 476
HphI GGTGA 3 cut(s) 20, 209, 485
Hpy188I TCNGA 5 cut(s) 58, 67, 76, 97, 406
Hpy188III TCNNGA 1 cut(s) 141
HpyAV CCTTC 1 cut(s) 449
HpyCH4V TGCA 4 cut(s) 120, 289, 352, 485
HpyF3I CTNAG 2 cut(s) 273, 417
Hsp92II CATG 2 cut(s) 446, 485
Kzo9I GATC 1 cut(s) 401
LpnPI CCDG 2 cut(s) 275, 338
MalI GATC 1 cut(s) 403
MboI GATC 1 cut(s) 401
MboII GAAGA 7 cut(s) 32, 95, 113, 185, 260, 303, 368
MfeI CAATTG 1 cut(s) 125
MflI RGATCY 1 cut(s) 401
MluCI AATT 9 cut(s) 52, 125, 144, 180, 185, 347, 359, 389, 429
MnlI CCTC 4 cut(s) 16, 55, 148, 169
MseI TTAA 6 cut(s) 51, 153, 300, 317, 365, 384
MspCI CTTAAG 1 cut(s) 152
MunI CAATTG 1 cut(s) 125
NdeII GATC 1 cut(s) 401
NlaIII CATG 2 cut(s) 446, 485
PfeI GAWTC 1 cut(s) 476
PsuI RGATCY 1 cut(s) 401
RsaI GTAC 1 cut(s) 259
RsaNI GTAC 1 cut(s) 258
SaqAI TTAA 6 cut(s) 51, 153, 300, 317, 365, 384
Sau3AI GATC 1 cut(s) 401
SetI ASST 5 cut(s) 27, 267, 294, 383, 442
SmlI CTYRAG 3 cut(s) 139, 152, 335
SmoI CTYRAG 3 cut(s) 139, 152, 335
Sse9I AATT 9 cut(s) 52, 125, 144, 180, 185, 347, 359, 389, 429
TasI AATT 9 cut(s) 52, 125, 144, 180, 185, 347, 359, 389, 429
TfiI GAWTC 1 cut(s) 476
Tru1I TTAA 6 cut(s) 51, 153, 300, 317, 365, 384
Tru9I TTAA 6 cut(s) 51, 153, 300, 317, 365, 384
TspDTI ATGAA 3 cut(s) 33, 114, 126
Vha464I CTTAAG 1 cut(s) 152
XapI RAATTY 2 cut(s) 185, 389
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.