Rroxscaffold_2G00123320

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
57186463 .. 57191955
5493 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00123320.1

Sequence Viewer

Length: 399 bp
ATGGTCAAGAAAAGCTTGAACAAGTTCTCTATAGGGTCCGAAAAGGTCTCAAAAATGATTGGATTAGGCAAAGCTCATTGCAACAAAGAGGGATTAGGATACAATGGTGAGACCTGCAAGCCTTTAAGGTTTGTAAAAGGTGTGGAATGTGAAAGCTCATCAAGTCAGCCACAAAGTTCTTGTGAAAATGGGTCCGGTTCCAAGTTGCTTGCAAAATCGAACCACGTGTGGCTCACCAAACACTTCGTAAAAGCTCTCGGTAAGTCCCCGACAAACTTTGTCGCAAAGGTATATTCACAGCCCCAAAATCCTACTTGTCATTATTGTGGAAAATTCGGACACATACGTCCTAGGTGCAATATGCTTCATAGGGCTACTCAAAATCGAGGAAAACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

132

Amino Acids

14.55

Weight (kDa)

9.89

Isoelectric Point (pI)

42.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 345
Acc36I ACCTGC 1 cut(s) 122
AcsI RAATTY 1 cut(s) 332
AcvI CACGTG 1 cut(s) 226
AflIII ACRYGT 1 cut(s) 225
AgsI TTSAA 1 cut(s) 19
AluBI AGCT 4 cut(s) 15, 74, 156, 254
AluI AGCT 4 cut(s) 15, 74, 156, 254
Alw26I GTCTC 2 cut(s) 52, 104
ApoI RAATTY 1 cut(s) 332
Asp700I GAANNNNTTC 1 cut(s) 23
AspA2I CCTAGG 1 cut(s) 350
AspS9I GGNCC 2 cut(s) 36, 192
AsuHPI GGTGA 2 cut(s) 119, 226
AvaII GGWCC 2 cut(s) 36, 192
AvrII CCTAGG 1 cut(s) 350
BaeI ACNNNNGTAYC 2 cut(s) 91, 124
BbrPI CACGTG 1 cut(s) 226
BciVI GTATCC 1 cut(s) 92
BcoDI GTCTC 2 cut(s) 52, 104
BfaI CTAG 1 cut(s) 351
BfmI CTRYAG 1 cut(s) 30
BfuAI ACCTGC 1 cut(s) 122
BfuI GTATCC 1 cut(s) 92
BlnI CCTAGG 1 cut(s) 350
Bme18I GGWCC 2 cut(s) 36, 192
BmgT120I GGNCC 2 cut(s) 36, 192
BmiI GGNNCC 3 cut(s) 37, 193, 199
BsaAI YACGTR 1 cut(s) 226
BsaI GGTCTC 2 cut(s) 52, 104
BsaJI CCNNGG 1 cut(s) 350
BsaWI WCCGGW 1 cut(s) 194
Bse3DI GCAATG 1 cut(s) 76
BseDI CCNNGG 1 cut(s) 350
BseMI GCAATG 1 cut(s) 76
BsiSI CCGG 1 cut(s) 195
BslFI GGGAC 1 cut(s) 250
BsmAI GTCTC 2 cut(s) 52, 104
BsmFI GGGAC 1 cut(s) 250
Bso31I GGTCTC 2 cut(s) 52, 104
BspLI GGNNCC 3 cut(s) 37, 193, 199
BspMI ACCTGC 1 cut(s) 122
BspTNI GGTCTC 2 cut(s) 52, 104
BsrDI GCAATG 1 cut(s) 76
BssECI CCNNGG 1 cut(s) 350
BssT1I CCWWGG 1 cut(s) 350
BstBAI YACGTR 1 cut(s) 226
BstC8I GCNNGC 2 cut(s) 119, 210
BstMAI GTCTC 2 cut(s) 52, 104
BstSFI CTRYAG 1 cut(s) 30
BsuI GTATCC 1 cut(s) 92
BveI ACCTGC 1 cut(s) 122
Cac8I GCNNGC 2 cut(s) 119, 210
Cfr13I GGNCC 2 cut(s) 36, 192
CviJI RGCY 9 cut(s) 15, 74, 121, 156, 169, 232, 254, 301, 374
CviKI_1 RGCY 9 cut(s) 15, 74, 121, 156, 169, 232, 254, 301, 374
DrdI GACNNNNNNGTC 1 cut(s) 345
DseDI GACNNNNNNGTC 1 cut(s) 345
Eco130I CCWWGG 1 cut(s) 350
Eco31I GGTCTC 2 cut(s) 52, 104
Eco47I GGWCC 2 cut(s) 36, 192
Eco72I CACGTG 1 cut(s) 226
EcoT14I CCWWGG 1 cut(s) 350
ErhI CCWWGG 1 cut(s) 350
FaiI YATR 5 cut(s) 32, 292, 344, 362, 369
FalI AAGNNNNNCTT 1 cut(s) 31
FaqI GGGAC 1 cut(s) 250
FspBI CTAG 1 cut(s) 351
HapII CCGG 1 cut(s) 195
HindIII AAGCTT 1 cut(s) 13
HpaII CCGG 1 cut(s) 195
HphI GGTGA 2 cut(s) 119, 226
Hpy188I TCNGA 2 cut(s) 40, 338
Hpy188III TCNNGA 1 cut(s) 7
HpyCH4IV ACGT 2 cut(s) 225, 346
HpyCH4V TGCA 4 cut(s) 81, 117, 212, 357
HpySE526I ACGT 2 cut(s) 225, 346
LpnPI CCDG 2 cut(s) 127, 208
MaeI CTAG 1 cut(s) 351
MaeII ACGT 2 cut(s) 225, 346
MluCI AATT 1 cut(s) 332
MnlI CCTC 2 cut(s) 82, 380
MroXI GAANNNNTTC 1 cut(s) 23
MseI TTAA 1 cut(s) 125
MslI CAYNNNNRTG 1 cut(s) 324
MspI CCGG 1 cut(s) 195
NlaIV GGNNCC 3 cut(s) 37, 193, 199
PdmI GAANNNNTTC 1 cut(s) 23
PmaCI CACGTG 1 cut(s) 226
PmlI CACGTG 1 cut(s) 226
Ppu21I YACGTR 1 cut(s) 226
PspCI CACGTG 1 cut(s) 226
PspN4I GGNNCC 3 cut(s) 37, 193, 199
PspPI GGNCC 2 cut(s) 36, 192
RseI CAYNNNNRTG 1 cut(s) 324
SaqAI TTAA 1 cut(s) 125
Sau96I GGNCC 2 cut(s) 36, 192
SfcI CTRYAG 1 cut(s) 30
SinI GGWCC 2 cut(s) 36, 192
SmiMI CAYNNNNRTG 1 cut(s) 324
Sse9I AATT 1 cut(s) 332
SspMI CTAG 1 cut(s) 351
StyI CCWWGG 1 cut(s) 350
TaiI ACGT 2 cut(s) 228, 349
TaqI TCGA 2 cut(s) 218, 385
TasI AATT 1 cut(s) 332
Tru1I TTAA 1 cut(s) 125
Tru9I TTAA 1 cut(s) 125
TspDTI ATGAA 1 cut(s) 356
VpaK11BI GGWCC 2 cut(s) 36, 192
XapI RAATTY 1 cut(s) 332
XmaJI CCTAGG 1 cut(s) 350
XmnI GAANNNNTTC 1 cut(s) 23
XspI CTAG 1 cut(s) 351
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.