Rmu_ssc0000162.1_g000012

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000162.1
Physical Location & Seq
Forward (+)
63908 .. 64231
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000162.1_g000012.1.cds

Sequence Viewer

Length: 324 bp
atgggtgagaaagagaagattgagaaaagatttgaattatccttgaaagaatgggaagatgagcgtactgaccttgttgctaagataaatgttttgcagggtaaggtcaagtctcaaaattgggacaaggagcatgatgagattactaacaaaatcaaagctttgcaggttgaaattaaggctcaatcttccttaaatgtgtctctaacccttgagaatgagaaattgcaggaagaattattgagggtcaaggaaaactttaacaaattctccattggatctgaatgggaattggcaaagctcatggcaataaagaaggattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

12.57

Weight (kDa)

5.6

Isoelectric Point (pI)

34.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 157
AclWI GGATC 1 cut(s) 286
AcsI RAATTY 1 cut(s) 266
AfaI GTAC 1 cut(s) 67
AgsI TTSAA 3 cut(s) 35, 46, 173
AluBI AGCT 2 cut(s) 161, 301
AluI AGCT 2 cut(s) 161, 301
Alw26I GTCTC 2 cut(s) 117, 207
AlwI GGATC 1 cut(s) 286
ApoI RAATTY 1 cut(s) 266
AsuHPI GGTGA 1 cut(s) 17
BcoDI GTCTC 2 cut(s) 117, 207
BfuAI ACCTGC 1 cut(s) 157
BpuEI CTTGAG 1 cut(s) 233
BsaXI ACNNNNNCTCC 2 cut(s) 254, 284
BslFI GGGAC 1 cut(s) 137
BsmAI GTCTC 2 cut(s) 117, 207
BsmFI GGGAC 1 cut(s) 137
Bsp143I GATC 1 cut(s) 278
BspMI ACCTGC 1 cut(s) 157
BspPI GGATC 1 cut(s) 286
BssMI GATC 1 cut(s) 278
BstDEI CTNAG 1 cut(s) 81
BstKTI GATC 1 cut(s) 281
BstMAI GTCTC 2 cut(s) 117, 207
BstMBI GATC 1 cut(s) 278
BstX2I RGATCY 1 cut(s) 278
BstYI RGATCY 1 cut(s) 278
BveI ACCTGC 1 cut(s) 157
Csp6I GTAC 1 cut(s) 66
CviAII CATG 2 cut(s) 134, 304
CviJI RGCY 3 cut(s) 161, 182, 301
CviKI_1 RGCY 3 cut(s) 161, 182, 301
CviQI GTAC 1 cut(s) 66
DdeI CTNAG 1 cut(s) 81
DpnI GATC 1 cut(s) 280
DpnII GATC 1 cut(s) 278
FaeI CATG 2 cut(s) 137, 307
FaiI YATR 2 cut(s) 135, 305
FalI AAGNNNNNCTT 2 cut(s) 242, 274
FaqI GGGAC 1 cut(s) 137
FatI CATG 2 cut(s) 133, 303
Hin1II CATG 2 cut(s) 137, 307
HindIII AAGCTT 1 cut(s) 159
HphI GGTGA 1 cut(s) 17
Hpy188I TCNGA 1 cut(s) 283
HpyAV CCTTC 1 cut(s) 310
HpyCH4V TGCA 3 cut(s) 97, 166, 229
HpyF3I CTNAG 1 cut(s) 81
Hsp92II CATG 2 cut(s) 137, 307
Kzo9I GATC 1 cut(s) 278
LmnI GCTCC 1 cut(s) 130
LpnPI CCDG 3 cut(s) 83, 152, 215
MalI GATC 1 cut(s) 280
MboI GATC 1 cut(s) 278
MboII GAAGA 4 cut(s) 28, 68, 180, 245
MflI RGATCY 1 cut(s) 278
MluCI AATT 7 cut(s) 35, 118, 174, 224, 236, 266, 290
MnlI CCTC 1 cut(s) 237
MseI TTAA 3 cut(s) 177, 194, 261
NdeII GATC 1 cut(s) 278
NlaIII CATG 2 cut(s) 137, 307
PsuI RGATCY 1 cut(s) 278
RsaI GTAC 1 cut(s) 67
RsaNI GTAC 1 cut(s) 66
SaqAI TTAA 3 cut(s) 177, 194, 261
Sau3AI GATC 1 cut(s) 278
SetI ASST 5 cut(s) 75, 108, 163, 171, 303
SmlI CTYRAG 1 cut(s) 212
SmoI CTYRAG 1 cut(s) 212
Sse9I AATT 7 cut(s) 35, 118, 174, 224, 236, 266, 290
TasI AATT 7 cut(s) 35, 118, 174, 224, 236, 266, 290
Tru1I TTAA 3 cut(s) 177, 194, 261
Tru9I TTAA 3 cut(s) 177, 194, 261
XapI RAATTY 1 cut(s) 266
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.