Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005087.1

Orthogroup ID

OG0000703

Physical Location & Seq

Genomic Coordinates Forward (+)

17600 .. 21799

Gene Structure 4200 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005087.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 762 bp

atggggtctgaaggtcatgagtcacagatggttgctgatggcgactttgatgttgatttcctgactagacggagtctgaaatcatatgtcacagatggtgatagatcacagatggtgatcaaggcaggaaataggtcaggaaaatcgtggctgaagctgaaggagcttgttggcagcagaacgggtaggaagcaatttttgttggctttgccaatatatgacttccgctatgcagagactccaatatcatggacaccagacttggtggacagtgttgcacgccggactcttaagtcaacttggagcgacgttgaggaagattctcaaactgagaatgaagaagagaacattgcattcacctgctcacttcatcatgaggcatctgatgattctgacaatgaaggtgagatttttgatgtaactgatgatgagaataatgataagtgcagggaaccgtataaagcttcaagagggatgcccaaaagaaatctcaagctagagaacgagaatgagcaagtggaacgtactgagttgattgacaggattaaaacccttcaggttgaagttaaagctcaatcgaatttgaatgtctcactaacctctgaaattgagaatttgcaggttaagcttgaagagtctcaacaaaagttttctaaattctcaattgggtcagacaaagtgtctagaatgattgggatgggaaaatccgaaggtgacaaaaaaggcacaagttctagttctgatgagagctctaaattttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Retrotran_gag_2 zf-CCHC

Protein Analysis

253

Amino Acids

28.61

Weight (kDa)

4.88

Isoelectric Point (pI)

47.93

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000703)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g12811 FvH4_1g24841 FvH4_2g03460 FvH4_2g30311 FvH4_3g16731 FvH4_3g16931 FvH4_3g21841 FvH4_3g31692 FvH4_3g35772 FvH4_3g37482 FvH4_4g03991 FvH4_4g08241 FvH4_4g09290 FvH4_4g14651 FvH4_4g18201 FvH4_5g17842 FvH4_5g18993 FvH4_6g19711 FvH4_6g36421 FvH4_6g45941 FvH4_6g45942 FvH4_7g03942 FvH4_7g10731 FvH4_7g33141
prunus_persica	Prupe.1G185200_v2.0.a1
pyrus_communis	pycom01g05340 pycom05g05480 pycom14g05470
rosa_chinensis	RchiOBHm_Chr2g0143791 RchiOBHm_Chr2g0164531 RchiOBHm_Chr2g0174931 RchiOBHm_Chr3g0456701 RchiOBHm_Chr3g0462591 RchiOBHm_Chr3g0488601 RchiOBHm_Chr3g0489031 RchiOBHm_Chr4g0421211 RchiOBHm_Chr4g0421221 RchiOBHm_Chr6g0278461 RchiOBHm_Chr7g0183661 RchiOBHm_Chr7g0219131
rosa_multiflora	Rmu_co8327135.1_g000001 Rmu_co8385793.1_g000001 Rmu_co8398081.1_g000001 Rmu_sc0000721.1_g000029 Rmu_sc0000898.1_g000075 Rmu_sc0001156.1_g000001 Rmu_sc0003339.1_g000002 Rmu_sc0003505.1_g000007 Rmu_sc0003673.1_g000008 Rmu_sc0005071.1_g000010 Rmu_sc0005087.1_g000005 Rmu_sc0005350.1_g000007 Rmu_ssc0000118.1_g000016 Rmu_ssc0000162.1_g000012
rosa_roxburghii	Rroxscaffold_2G00123320 Rroxscaffold_3G00238750 Rroxscaffold_4G00300220 Rroxscaffold_5G00382590 Rroxscaffold_7G00206960
rosa_samantha	Rh1CG187800 Rh2BG032400 Rh4DG325100 Rh5CG260800 Rh6AG171500 Rh6AG472000
rosa_wichuraiana	Rw1G003490 Rw1G007660 Rw2G031060 Rw3G014070 Rw3G014230 Rw6G006100 Rw6G019680 Rw7G016530 Rw7G032660

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	368
AasI	GACNNNNNNGTC	1 cut(s)	292
Acc36I	ACCTGC	2 cut(s)	368, 610
AciI	CCGC	1 cut(s)	226
AcsI	RAATTY	4 cut(s)	580, 613, 656, 755
AcuI	CTGAAG	4 cut(s)	30, 173, 179, 539
AfaI	GTAC	1 cut(s)	526
AflII	CTTAAG	1 cut(s)	290
AgsI	TTSAA	4 cut(s)	468, 563, 586, 632
AhdI	GACNNNNNGTC	1 cut(s)	679
AluBI	AGCT	7 cut(s)	157, 166, 464, 496, 572, 628, 750
AluI	AGCT	7 cut(s)	157, 166, 464, 496, 572, 628, 750
Alw21I	GWGCWC	1 cut(s)	752
Alw26I	GTCTC	3 cut(s)	230, 595, 642
ApeKI	GCWGC	1 cut(s)	174
ApoI	RAATTY	4 cut(s)	580, 613, 656, 755
AsuHPI	GGTGA	5 cut(s)	110, 127, 349, 416, 725
BanII	GRGCYC	1 cut(s)	752
Bbv12I	GWGCWC	1 cut(s)	752
BbvI	GCAGC	1 cut(s)	186
BccI	CCATC	5 cut(s)	22, 32, 89, 106, 691
BclI	TGATCA	1 cut(s)	117
BcoDI	GTCTC	3 cut(s)	230, 595, 642
BfaI	CTAG	4 cut(s)	66, 497, 684, 735
BfrI	CTTAAG	1 cut(s)	290
BfuAI	ACCTGC	2 cut(s)	368, 610
BisI	GCNGC	1 cut(s)	175
BlsI	GCNGC	1 cut(s)	176
BmeRI	GACNNNNNGTC	1 cut(s)	679
BmiI	GGNNCC	1 cut(s)	453
BmsI	GCATC	2 cut(s)	389, 465
BpuEI	CTTGAG	1 cut(s)	476
BsaBI	GATNNNNATC	1 cut(s)	116
Bse3DI	GCAATG	1 cut(s)	348
Bse8I	GATNNNNATC	1 cut(s)	116
BseGI	GGATG	2 cut(s)	480, 702
BseJI	GATNNNNATC	1 cut(s)	116
BseMI	GCAATG	1 cut(s)	348
BseMII	CTCAG	2 cut(s)	321, 519
BseXI	GCAGC	1 cut(s)	186
BsgI	GTGCAG	1 cut(s)	466
BsiHKAI	GWGCWC	1 cut(s)	752
BsiSI	CCGG	1 cut(s)	283
BsmAI	GTCTC	3 cut(s)	230, 595, 642
BsmI	GAATGC	1 cut(s)	353
Bsp1286I	GDGCHC	1 cut(s)	752
Bsp143I	GATC	2 cut(s)	104, 117
BspACI	CCGC	1 cut(s)	226
BspCNI	CTCAG	2 cut(s)	322, 520
BspHI	TCATGA	2 cut(s)	16, 373
BspLI	GGNNCC	1 cut(s)	453
BspMI	ACCTGC	2 cut(s)	368, 610
BspTI	CTTAAG	1 cut(s)	290
BsrDI	GCAATG	1 cut(s)	348
BssMI	GATC	2 cut(s)	104, 117
Bst4CI	ACNGT	2 cut(s)	272, 456
Bst6I	CTCTTC	2 cut(s)	336, 627
BstAFI	CTTAAG	1 cut(s)	290
BstC8I	GCNNGC	1 cut(s)	280
BstDEI	CTNAG	2 cut(s)	330, 528
BstF5I	GGATG	2 cut(s)	480, 702
BstKTI	GATC	2 cut(s)	107, 120
BstMAI	GTCTC	3 cut(s)	230, 595, 642
BstMBI	GATC	2 cut(s)	104, 117
BstMWI	GCNNNNNNNGC	2 cut(s)	163, 625
BstV1I	GCAGC	1 cut(s)	186
BstXI	CCANNNNNNTGG	1 cut(s)	249
BtsCI	GGATG	2 cut(s)	480, 702
BtsIMutI	CAGTG	1 cut(s)	277
BveI	ACCTGC	2 cut(s)	368, 610
Cac8I	GCNNGC	1 cut(s)	280
CciI	TCATGA	2 cut(s)	16, 373
Csp6I	GTAC	1 cut(s)	525
CviAII	CATG	3 cut(s)	17, 249, 374
CviJI	RGCY	9 cut(s)	151, 157, 166, 206, 464, 496, 572, 628, 750
CviKI_1	RGCY	9 cut(s)	151, 157, 166, 206, 464, 496, 572, 628, 750
CviQI	GTAC	1 cut(s)	525
DdeI	CTNAG	2 cut(s)	330, 528
DpnI	GATC	2 cut(s)	106, 119
DpnII	GATC	2 cut(s)	104, 117
DrdI	GACNNNNNNGTC	1 cut(s)	292
DriI	GACNNNNNGTC	1 cut(s)	679
DseDI	GACNNNNNNGTC	1 cut(s)	292
Eam1104I	CTCTTC	2 cut(s)	336, 627
Eam1105I	GACNNNNNGTC	1 cut(s)	679
EarI	CTCTTC	2 cut(s)	336, 627
Ecl136II	GAGCTC	1 cut(s)	750
Eco24I	GRGCYC	1 cut(s)	752
Eco53kI	GAGCTC	1 cut(s)	750
Eco57I	CTGAAG	4 cut(s)	30, 173, 179, 539
EcoICRI	GAGCTC	1 cut(s)	750
EcoT38I	GRGCYC	1 cut(s)	752
FaeI	CATG	3 cut(s)	20, 252, 377
FaiI	YATR	9 cut(s)	18, 85, 87, 217, 219, 231, 250, 375, 459
FatI	CATG	3 cut(s)	16, 248, 373
FauNDI	CATATG	1 cut(s)	85
FbaI	TGATCA	1 cut(s)	117
Fnu4HI	GCNGC	1 cut(s)	175
FokI	GGATG	2 cut(s)	487, 709
FriOI	GRGCYC	1 cut(s)	752
Fsp4HI	GCNGC	1 cut(s)	175
FspBI	CTAG	4 cut(s)	66, 497, 684, 735
GluI	GCNGC	1 cut(s)	175
HapII	CCGG	1 cut(s)	283
Hin1II	CATG	3 cut(s)	20, 252, 377
HincII	GTYRAC	1 cut(s)	297
HindII	GTYRAC	1 cut(s)	297
HindIII	AAGCTT	2 cut(s)	462, 626
HinfI	GANTC	7 cut(s)	20, 73, 238, 286, 320, 389, 635
HpaII	CCGG	1 cut(s)	283
HphI	GGTGA	5 cut(s)	110, 127, 349, 416, 725
Hpy166II	GTNNAC	2 cut(s)	268, 297
Hpy188I	TCNGA	8 cut(s)	10, 78, 385, 394, 604, 673, 709, 742
Hpy188III	TCNNGA	6 cut(s)	17, 61, 138, 374, 468, 684
Hpy8I	GTNNAC	2 cut(s)	268, 297
Hpy99I	CGWCG	1 cut(s)	311
HpyAV	CCTTC	5 cut(s)	5, 154, 395, 563, 704
HpyCH4III	ACNGT	2 cut(s)	272, 456
HpyCH4IV	ACGT	2 cut(s)	309, 523
HpyCH4V	TGCA	5 cut(s)	233, 278, 353, 447, 619
HpyF10VI	GCNNNNNNNGC	2 cut(s)	163, 625
HpyF3I	CTNAG	2 cut(s)	330, 528
HpySE526I	ACGT	2 cut(s)	309, 523
Hsp92II	CATG	3 cut(s)	20, 252, 377
Ksp22I	TGATCA	1 cut(s)	117
Kzo9I	GATC	2 cut(s)	104, 117
LmnI	GCTCC	2 cut(s)	163, 303
Lsp1109I	GCAGC	1 cut(s)	186
LweI	GCATC	2 cut(s)	389, 465
MaeI	CTAG	4 cut(s)	66, 497, 684, 735
MaeII	ACGT	2 cut(s)	309, 523
MaeIII	GTNAC	4 cut(s)	21, 88, 418, 713
MalI	GATC	2 cut(s)	106, 119
MboI	GATC	2 cut(s)	104, 117
MboII	GAAGA	4 cut(s)	329, 350, 353, 644
MfeI	CAATTG	1 cut(s)	663
MhlI	GDGCHC	1 cut(s)	752
MluCI	AATT	7 cut(s)	194, 580, 606, 613, 656, 663, 755
MlyI	GAGTC	5 cut(s)	29, 82, 232, 280, 644
MnlI	CCTC	4 cut(s)	307, 370, 464, 610
MseI	TTAA	4 cut(s)	291, 546, 567, 624
MspCI	CTTAAG	1 cut(s)	290
MspI	CCGG	1 cut(s)	283
MunI	CAATTG	1 cut(s)	663
Mva1269I	GAATGC	1 cut(s)	353
MwoI	GCNNNNNNNGC	2 cut(s)	163, 625
NdeI	CATATG	1 cut(s)	85
NdeII	GATC	2 cut(s)	104, 117
NlaIII	CATG	3 cut(s)	20, 252, 377
NlaIV	GGNNCC	1 cut(s)	453
NmuCI	GTSAC	3 cut(s)	21, 88, 713
PagI	TCATGA	2 cut(s)	16, 373
PaqCI	CACCTGC	1 cut(s)	368
PctI	GAATGC	1 cut(s)	353
PfeI	GAWTC	2 cut(s)	320, 389
PflFI	GACNNNGTC	1 cut(s)	72
PkrI	GCNGC	1 cut(s)	176
PleI	GAGTC	5 cut(s)	28, 81, 232, 280, 643
PpsI	GAGTC	5 cut(s)	28, 81, 232, 280, 643
Psp124BI	GAGCTC	1 cut(s)	752
PspN4I	GGNNCC	1 cut(s)	453
PsyI	GACNNNGTC	1 cut(s)	72
RsaI	GTAC	1 cut(s)	526
RsaNI	GTAC	1 cut(s)	525
SacI	GAGCTC	1 cut(s)	752
SaqAI	TTAA	4 cut(s)	291, 546, 567, 624
SatI	GCNGC	1 cut(s)	175
Sau3AI	GATC	2 cut(s)	104, 117
SchI	GAGTC	5 cut(s)	29, 82, 232, 280, 644
SduI	GDGCHC	1 cut(s)	752
SfaNI	GCATC	2 cut(s)	389, 465
SmlI	CTYRAG	2 cut(s)	290, 491
SmoI	CTYRAG	2 cut(s)	290, 491
Sse9I	AATT	7 cut(s)	194, 580, 606, 613, 656, 663, 755
SsiI	CCGC	1 cut(s)	226
SspMI	CTAG	4 cut(s)	66, 497, 684, 735
SstI	GAGCTC	1 cut(s)	752
TaaI	ACNGT	2 cut(s)	272, 456
TaiI	ACGT	2 cut(s)	312, 526
TaqI	TCGA	1 cut(s)	578
TasI	AATT	7 cut(s)	194, 580, 606, 613, 656, 663, 755
TfiI	GAWTC	2 cut(s)	320, 389
Tru1I	TTAA	4 cut(s)	291, 546, 567, 624
Tru9I	TTAA	4 cut(s)	291, 546, 567, 624
TscAI	CASTG	1 cut(s)	277
TseFI	GTSAC	3 cut(s)	21, 88, 713
TseI	GCWGC	1 cut(s)	174
Tsp45I	GTSAC	3 cut(s)	21, 88, 713
TspDTI	ATGAA	3 cut(s)	351, 359, 414
TspGWI	ACGGA	1 cut(s)	85
TspRI	CASTG	1 cut(s)	277
Tth111I	GACNNNGTC	1 cut(s)	72
Vha464I	CTTAAG	1 cut(s)	290
XapI	RAATTY	4 cut(s)	580, 613, 656, 755
XbaI	TCTAGA	1 cut(s)	683
XspI	CTAG	4 cut(s)	66, 497, 684, 735

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.