FvH4_2g17331

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
OG0000562
Physical Location & Seq
Forward (+)
14965760 .. 14966404
645 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g17331.t1

Sequence Viewer

Length: 636 bp
ATGGCTGAGATTGAAATCAGCTCCGCCTCAACTTCTGCTGCTTCACAAATCTCTGAAGCTGATTCAAACCCAAATCAACGTCTTTGTTCAGTTTTACTCAATGAGTTAAACTATATTCCTTGGTCAAGAGCCATCACTCTTGCTCTTGGTGGTAAAACCAAGCTTGGCTTCATCAATGGAAGCATTCAAATTCCAACCCCTCTATCCTCTGAGTATGAAACATGGCTCAGTAAAGATCAGCTTGTCATGTCCTGGATTCTCAACTCTATGGAGCCTTCAATTTCTGCTATTTTCAGCTACTCTGAGTCCTCGTTGCATCTCTGGAAATCTGTGAAAGAGATGTATGGGAATCAAAACAACTGTGCTAGAGTTTTTCAGCTTCAAAGAGACATAACCAGTTTTAAGCAAGGAGCAACCTCTTTTGTTCATCATCTTGGCAGCATGAAGGGCATGTGGAATGAGATAGATCTATACAGACCTCACACTGTTGATCCAACCATCCTTCTAAAGAGAGCTGAGGAAGATAAAGTCTTCCAACTTCTAGCCAGCTTAGGCCCTGAGTATGAAGACCTTCGAAGCCACATCCTCATGAGTGCTGAACTGTCAACTTTATCCAGCATATGTGCTACCATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 Retrotran_gag_3 rve

Protein Analysis

212

Amino Acids

23.55

Weight (kDa)

5.36

Isoelectric Point (pI)

42.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotran_gag_3 PF14244 23 - 65 2.4e-14 gag-polypeptide of LTR copia-type
Retrotran_gag_2 PF14223 59 - 207 8.3e-10 gag-polypeptide of LTR copia-type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 24
AclWI GGATC 1 cut(s) 485
AcsI RAATTY 1 cut(s) 189
AcuI CTGAAG 1 cut(s) 75
AgsI TTSAA 5 cut(s) 14, 66, 188, 279, 383
AjnI CCWGG 1 cut(s) 251
AjuI GAANNNNNNNTTGG 2 cut(s) 152, 184
AluBI AGCT 8 cut(s) 21, 59, 163, 241, 297, 379, 515, 549
AluI AGCT 8 cut(s) 21, 59, 163, 241, 297, 379, 515, 549
Alw26I GTCTC 1 cut(s) 381
AlwI GGATC 1 cut(s) 485
AoxI GGCC 1 cut(s) 553
ApeKI GCWGC 2 cut(s) 38, 438
ApoI RAATTY 1 cut(s) 189
Asp700I GAANNNNTTC 1 cut(s) 570
AspS9I GGNCC 1 cut(s) 554
AsuII TTCGAA 1 cut(s) 574
BbsI GAAGAC 2 cut(s) 523, 573
BbvCI CCTCAGC 1 cut(s) 516
BbvI GCAGC 2 cut(s) 25, 450
BccI CCATC 2 cut(s) 140, 506
BciT130I CCWGG 1 cut(s) 253
BcoDI GTCTC 1 cut(s) 381
BfaI CTAG 2 cut(s) 366, 542
BglII AGATCT 1 cut(s) 466
BisI GCNGC 2 cut(s) 39, 439
BlsI GCNGC 2 cut(s) 40, 440
Bme1390I CCNGG 1 cut(s) 253
BmgT120I GGNCC 1 cut(s) 554
BmiI GGNNCC 1 cut(s) 273
BmrFI CCNGG 1 cut(s) 253
BmsI GCATC 1 cut(s) 325
BpiI GAAGAC 2 cut(s) 523, 573
Bpu10I CCTNAGC 2 cut(s) 516, 550
Bpu14I TTCGAA 1 cut(s) 574
BsaBI GATNNNNATC 1 cut(s) 14
BsaJI CCNNGG 1 cut(s) 119
Bse1I ACTGG 1 cut(s) 396
Bse8I GATNNNNATC 1 cut(s) 14
BseBI CCWGG 1 cut(s) 253
BseDI CCNNGG 1 cut(s) 119
BseGI GGATG 2 cut(s) 498, 582
BseJI GATNNNNATC 1 cut(s) 14
BseMII CTCAG 5 cut(s) 201, 241, 294, 507, 549
BseNI ACTGG 1 cut(s) 396
BseXI GCAGC 2 cut(s) 25, 450
BshFI GGCC 1 cut(s) 555
BsmAI GTCTC 1 cut(s) 381
BsmI GAATGC 1 cut(s) 183
BsnI GGCC 1 cut(s) 555
Bsp119I TTCGAA 1 cut(s) 574
Bsp143I GATC 3 cut(s) 235, 466, 490
BspACI CCGC 1 cut(s) 24
BspANI GGCC 1 cut(s) 555
BspCNI CTCAG 5 cut(s) 202, 240, 295, 508, 550
BspHI TCATGA 1 cut(s) 588
BspLI GGNNCC 1 cut(s) 273
BspPI GGATC 1 cut(s) 485
BspT104I TTCGAA 1 cut(s) 574
BsrI ACTGG 1 cut(s) 396
BssECI CCNNGG 1 cut(s) 119
BssMI GATC 3 cut(s) 235, 466, 490
BssT1I CCWWGG 1 cut(s) 119
Bst2UI CCWGG 1 cut(s) 253
Bst4CI ACNGT 3 cut(s) 362, 487, 603
BstBI TTCGAA 1 cut(s) 574
BstC8I GCNNGC 1 cut(s) 547
BstDEI CTNAG 7 cut(s) 6, 210, 227, 303, 516, 550, 558
BstF5I GGATG 2 cut(s) 498, 582
BstKTI GATC 3 cut(s) 238, 469, 493
BstMAI GTCTC 1 cut(s) 381
BstMBI GATC 3 cut(s) 235, 466, 490
BstMWI GCNNNNNNNGC 1 cut(s) 447
BstNI CCWGG 1 cut(s) 253
BstNSI RCATGY 1 cut(s) 454
BstSCI CCNGG 1 cut(s) 251
BstV1I GCAGC 2 cut(s) 25, 450
BstV2I GAAGAC 2 cut(s) 523, 573
BstX2I RGATCY 1 cut(s) 466
BstYI RGATCY 1 cut(s) 466
BsuRI GGCC 1 cut(s) 555
BtsCI GGATG 2 cut(s) 498, 582
BtsIMutI CAGTG 1 cut(s) 483
Cac8I GCNNGC 1 cut(s) 547
CciI TCATGA 1 cut(s) 588
Cfr13I GGNCC 1 cut(s) 554
CviAII CATG 5 cut(s) 222, 247, 442, 451, 589
DdeI CTNAG 7 cut(s) 6, 210, 227, 303, 516, 550, 558
DpnI GATC 3 cut(s) 237, 468, 492
DpnII GATC 3 cut(s) 235, 466, 490
EciI GGCGGA 1 cut(s) 13
Eco130I CCWWGG 1 cut(s) 119
Eco57I CTGAAG 1 cut(s) 75
EcoO109I RGGNCCY 1 cut(s) 554
EcoRII CCWGG 1 cut(s) 251
EcoT14I CCWWGG 1 cut(s) 119
ErhI CCWWGG 1 cut(s) 119
FaeI CATG 5 cut(s) 225, 250, 445, 454, 592
FalI AAGNNNNNCTT 4 cut(s) 152, 184, 225, 257
FatI CATG 5 cut(s) 221, 246, 441, 450, 588
FauNDI CATATG 1 cut(s) 620
Fnu4HI GCNGC 2 cut(s) 39, 439
FokI GGATG 2 cut(s) 485, 569
Fsp4HI GCNGC 2 cut(s) 39, 439
FspBI CTAG 2 cut(s) 366, 542
GluI GCNGC 2 cut(s) 39, 439
HaeIII GGCC 1 cut(s) 555
Hin1II CATG 5 cut(s) 225, 250, 445, 454, 592
HincII GTYRAC 1 cut(s) 606
HindII GTYRAC 1 cut(s) 606
HindIII AAGCTT 1 cut(s) 161
HinfI GANTC 4 cut(s) 62, 256, 305, 349
Hpy166II GTNNAC 1 cut(s) 606
Hpy188I TCNGA 3 cut(s) 55, 211, 304
Hpy188III TCNNGA 3 cut(s) 126, 322, 589
Hpy8I GTNNAC 1 cut(s) 606
HpyAV CCTTC 4 cut(s) 285, 439, 512, 581
HpyCH4III ACNGT 3 cut(s) 362, 487, 603
HpyCH4IV ACGT 1 cut(s) 79
HpyCH4V TGCA 1 cut(s) 316
HpyF10VI GCNNNNNNNGC 1 cut(s) 447
HpyF3I CTNAG 7 cut(s) 6, 210, 227, 303, 516, 550, 558
HpySE526I ACGT 1 cut(s) 79
Hsp92II CATG 5 cut(s) 225, 250, 445, 454, 592
Kzo9I GATC 3 cut(s) 235, 466, 490
LmnI GCTCC 3 cut(s) 26, 271, 410
LpnPI CCDG 7 cut(s) 238, 265, 307, 409, 559, 570, 628
Lsp1109I GCAGC 2 cut(s) 25, 450
LweI GCATC 1 cut(s) 325
MaeI CTAG 2 cut(s) 366, 542
MaeII ACGT 1 cut(s) 79
MalI GATC 3 cut(s) 237, 468, 492
MboI GATC 3 cut(s) 235, 466, 490
MboII GAAGA 3 cut(s) 523, 533, 578
MflI RGATCY 1 cut(s) 466
MluCI AATT 2 cut(s) 189, 279
MlyI GAGTC 1 cut(s) 314
MmeI TCCRAC 3 cut(s) 218, 518, 559
MnlI CCTC 8 cut(s) 37, 210, 217, 319, 427, 489, 511, 596
MroXI GAANNNNTTC 1 cut(s) 570
MseI TTAA 2 cut(s) 107, 402
MslI CAYNNNNRTG 1 cut(s) 587
MspR9I CCNGG 1 cut(s) 253
Mva1269I GAATGC 1 cut(s) 183
MvaI CCWGG 1 cut(s) 253
MwoI GCNNNNNNNGC 1 cut(s) 447
NdeI CATATG 1 cut(s) 620
NdeII GATC 3 cut(s) 235, 466, 490
NlaIII CATG 5 cut(s) 225, 250, 445, 454, 592
NlaIV GGNNCC 1 cut(s) 273
NspI RCATGY 1 cut(s) 454
NspV TTCGAA 1 cut(s) 574
PagI TCATGA 1 cut(s) 588
PctI GAATGC 1 cut(s) 183
PdmI GAANNNNTTC 1 cut(s) 570
PfeI GAWTC 3 cut(s) 62, 256, 349
PfoI TCCNGGA 1 cut(s) 251
PkrI GCNGC 2 cut(s) 40, 440
PleI GAGTC 1 cut(s) 313
PpsI GAGTC 1 cut(s) 313
Psp6I CCWGG 1 cut(s) 251
PspGI CCWGG 1 cut(s) 251
PspN4I GGNNCC 1 cut(s) 273
PspPI GGNCC 1 cut(s) 554
PsuI RGATCY 1 cut(s) 466
RseI CAYNNNNRTG 1 cut(s) 587
SaqAI TTAA 2 cut(s) 107, 402
SatI GCNGC 2 cut(s) 39, 439
Sau3AI GATC 3 cut(s) 235, 466, 490
Sau96I GGNCC 1 cut(s) 554
SchI GAGTC 1 cut(s) 314
ScrFI CCNGG 1 cut(s) 253
SfaNI GCATC 1 cut(s) 325
SfuI TTCGAA 1 cut(s) 574
SmiMI CAYNNNNRTG 1 cut(s) 587
Sse9I AATT 2 cut(s) 189, 279
SsiI CCGC 1 cut(s) 24
SspMI CTAG 2 cut(s) 366, 542
StyD4I CCNGG 1 cut(s) 251
StyI CCWWGG 1 cut(s) 119
TaaI ACNGT 3 cut(s) 362, 487, 603
TaiI ACGT 1 cut(s) 82
TaqI TCGA 1 cut(s) 574
TasI AATT 2 cut(s) 189, 279
TfiI GAWTC 3 cut(s) 62, 256, 349
Tru1I TTAA 2 cut(s) 107, 402
Tru9I TTAA 2 cut(s) 107, 402
TscAI CASTG 1 cut(s) 490
TseI GCWGC 2 cut(s) 38, 438
TspDTI ATGAA 5 cut(s) 160, 231, 416, 458, 579
TspRI CASTG 1 cut(s) 490
XapI RAATTY 1 cut(s) 189
XceI RCATGY 1 cut(s) 454
XmnI GAANNNNTTC 1 cut(s) 570
XspI CTAG 2 cut(s) 366, 542
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.