Rw3G007590

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr3
OG0000562
Physical Location & Seq
Reverse (-)
6984075 .. 6986460
2386 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw3G007590.1

Sequence Viewer

Length: 513 bp
ATGAGTCCTGAACTACCATCCTTGACCAGCATCTGCTCTACCATTCAGCGTGAAGAAACTAGGAGGAAGGTCATGAATAAAGATTTAAAGACATTTGTATCTGAAGCTAGGGCTTTTGCAAGTGATCTTAAGCTAATTGAGAAGAAACCTTACAGAGGTAAACGCTCTGATCTCCATTGTAGTTATTGTGATCATCCTAGACATCTCAAAGAAAGGTGTTGGATACTGCATCCTGAACTCAAACCCAAATTTGAGAAACAATCTAGAGACACCAAGTCCTTTCCAAGAAATCATGGCCACAAGGCAAATCATGTTGCTTCTTCTACTGAGGGATTACTAAACTTCACTGCAAATCCAGCTGCATTGATAAATGAATTTGCATCTGTTTCTGAAGACTCAACAGCCCTACTTGGAAAATTTGCTGGTTTCCTAGCAGAAGCAGATGGAATAACTCATCCTAACATATTTGAGAAGGACGGTAACGTCACGTGTATAGGGCGCGTATCTGGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 Retrotran_gag_3 rve

Protein Analysis

170

Amino Acids

19.05

Weight (kDa)

8.99

Isoelectric Point (pI)

45.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 482
AccII CGCG 1 cut(s) 501
AcoI YGGCCR 1 cut(s) 295
AcsI RAATTY 3 cut(s) 248, 374, 416
AcuI CTGAAG 2 cut(s) 123, 411
AcvI CACGTG 1 cut(s) 489
AfiI CCNNNNNNNGG 1 cut(s) 155
AflII CTTAAG 1 cut(s) 128
AflIII ACRYGT 1 cut(s) 488
AhdI GACNNNNNGTC 1 cut(s) 274
AluBI AGCT 3 cut(s) 107, 133, 359
AluI AGCT 3 cut(s) 107, 133, 359
Alw26I GTCTC 1 cut(s) 261
AlwNI CAGNNNCTG 1 cut(s) 33
AoxI GGCC 1 cut(s) 295
ApeKI GCWGC 1 cut(s) 359
ApoI RAATTY 3 cut(s) 248, 374, 416
AspLEI GCGC 1 cut(s) 501
BaeI ACNNNNGTAYC 2 cut(s) 81, 114
BalI TGGCCA 1 cut(s) 297
BarI GAAGNNNNNNTAC 2 cut(s) 134, 166
BbrPI CACGTG 1 cut(s) 489
BbsI GAAGAC 1 cut(s) 399
BbvI GCAGC 1 cut(s) 346
BccI CCATC 2 cut(s) 25, 437
BciVI GTATCC 1 cut(s) 216
BclI TGATCA 1 cut(s) 190
BcoDI GTCTC 1 cut(s) 261
BfaI CTAG 5 cut(s) 60, 108, 198, 264, 431
BfrI CTTAAG 1 cut(s) 128
BfuI GTATCC 1 cut(s) 216
BisI GCNGC 1 cut(s) 360
BlsI GCNGC 1 cut(s) 361
BmeRI GACNNNNNGTC 1 cut(s) 274
BmsI GCATC 3 cut(s) 39, 238, 389
BpiI GAAGAC 1 cut(s) 399
BsaAI YACGTR 1 cut(s) 489
Bsc4I CCNNNNNNNGG 1 cut(s) 155
BseGI GGATG 4 cut(s) 17, 193, 229, 454
BseLI CCNNNNNNNGG 1 cut(s) 155
BseMII CTCAG 1 cut(s) 318
BseXI GCAGC 1 cut(s) 346
Bsh1236I CGCG 1 cut(s) 501
BshFI GGCC 1 cut(s) 297
BslI CCNNNNNNNGG 1 cut(s) 155
BsmAI GTCTC 1 cut(s) 261
BsnI GGCC 1 cut(s) 297
Bsp143I GATC 3 cut(s) 124, 169, 190
BspANI GGCC 1 cut(s) 297
BspCNI CTCAG 1 cut(s) 319
BspFNI CGCG 1 cut(s) 501
BspHI TCATGA 1 cut(s) 72
BspTI CTTAAG 1 cut(s) 128
BssMI GATC 3 cut(s) 124, 169, 190
Bst4CI ACNGT 1 cut(s) 479
BstAFI CTTAAG 1 cut(s) 128
BstBAI YACGTR 1 cut(s) 489
BstDEI CTNAG 1 cut(s) 327
BstENI CCTNNNNNAGG 1 cut(s) 153
BstF5I GGATG 4 cut(s) 17, 193, 229, 454
BstFNI CGCG 1 cut(s) 501
BstHHI GCGC 1 cut(s) 501
BstKTI GATC 3 cut(s) 127, 172, 193
BstMAI GTCTC 1 cut(s) 261
BstMBI GATC 3 cut(s) 124, 169, 190
BstMWI GCNNNNNNNGC 2 cut(s) 356, 507
BstUI CGCG 1 cut(s) 501
BstV1I GCAGC 1 cut(s) 346
BstV2I GAAGAC 1 cut(s) 399
BsuI GTATCC 1 cut(s) 216
BsuRI GGCC 1 cut(s) 297
BtsCI GGATG 4 cut(s) 17, 193, 229, 454
BtsI GCAGTG 1 cut(s) 345
BtsIMutI CAGTG 1 cut(s) 345
CaiI CAGNNNCTG 1 cut(s) 33
CciI TCATGA 1 cut(s) 72
CfoI GCGC 1 cut(s) 501
CviAII CATG 3 cut(s) 73, 293, 311
CviJI RGCY 7 cut(s) 107, 113, 133, 297, 359, 404, 510
CviKI_1 RGCY 7 cut(s) 107, 113, 133, 297, 359, 404, 510
DdeI CTNAG 1 cut(s) 327
DpnI GATC 3 cut(s) 126, 171, 192
DpnII GATC 3 cut(s) 124, 169, 190
DraI TTTAAA 1 cut(s) 87
DrdI GACNNNNNNGTC 1 cut(s) 482
DriI GACNNNNNGTC 1 cut(s) 274
DseDI GACNNNNNNGTC 1 cut(s) 482
EaeI YGGCCR 1 cut(s) 295
Eam1105I GACNNNNNGTC 1 cut(s) 274
Eco57I CTGAAG 2 cut(s) 123, 411
Eco72I CACGTG 1 cut(s) 489
EcoNI CCTNNNNNAGG 1 cut(s) 153
FaeI CATG 3 cut(s) 76, 296, 314
FaiI YATR 5 cut(s) 74, 294, 312, 464, 494
FatI CATG 3 cut(s) 72, 292, 310
FbaI TGATCA 1 cut(s) 190
Fnu4HI GCNGC 1 cut(s) 360
FokI GGATG 4 cut(s) 4, 180, 216, 441
Fsp4HI GCNGC 1 cut(s) 360
FspBI CTAG 5 cut(s) 60, 108, 198, 264, 431
GlaI GCGC 1 cut(s) 500
GluI GCNGC 1 cut(s) 360
HaeIII GGCC 1 cut(s) 297
HhaI GCGC 1 cut(s) 501
Hin1II CATG 3 cut(s) 76, 296, 314
Hin6I GCGC 1 cut(s) 499
HinP1I GCGC 1 cut(s) 499
HinfI GANTC 2 cut(s) 4, 395
Hpy166II GTNNAC 1 cut(s) 161
Hpy188I TCNGA 3 cut(s) 103, 169, 391
Hpy188III TCNNGA 4 cut(s) 8, 73, 233, 264
Hpy8I GTNNAC 1 cut(s) 161
HpyAV CCTTC 2 cut(s) 61, 466
HpyCH4III ACNGT 1 cut(s) 479
HpyCH4IV ACGT 2 cut(s) 483, 488
HpyCH4V TGCA 5 cut(s) 119, 229, 350, 362, 380
HpyF10VI GCNNNNNNNGC 2 cut(s) 356, 507
HpyF3I CTNAG 1 cut(s) 327
HpySE526I ACGT 2 cut(s) 483, 488
Hsp92II CATG 3 cut(s) 76, 296, 314
HspAI GCGC 1 cut(s) 499
Ksp22I TGATCA 1 cut(s) 190
Kzo9I GATC 3 cut(s) 124, 169, 190
LpnPI CCDG 6 cut(s) 21, 40, 246, 369, 408, 492
Lsp1109I GCAGC 1 cut(s) 346
LweI GCATC 3 cut(s) 39, 238, 389
MaeI CTAG 5 cut(s) 60, 108, 198, 264, 431
MaeII ACGT 2 cut(s) 483, 488
MaeIII GTNAC 2 cut(s) 479, 484
MalI GATC 3 cut(s) 126, 171, 192
MboI GATC 3 cut(s) 124, 169, 190
MboII GAAGA 4 cut(s) 65, 154, 312, 404
MlsI TGGCCA 1 cut(s) 297
MluCI AATT 4 cut(s) 135, 248, 374, 416
MluNI TGGCCA 1 cut(s) 297
MlyI GAGTC 2 cut(s) 13, 389
MmeI TCCRAC 1 cut(s) 200
MnlI CCTC 3 cut(s) 57, 149, 322
Mox20I TGGCCA 1 cut(s) 297
MscI TGGCCA 1 cut(s) 297
MseI TTAA 2 cut(s) 86, 129
Msp20I TGGCCA 1 cut(s) 297
MspA1I CMGCKG 1 cut(s) 359
MspCI CTTAAG 1 cut(s) 128
MvnI CGCG 1 cut(s) 501
MwoI GCNNNNNNNGC 2 cut(s) 356, 507
NdeII GATC 3 cut(s) 124, 169, 190
NlaIII CATG 3 cut(s) 76, 296, 314
NmuCI GTSAC 1 cut(s) 484
PagI TCATGA 1 cut(s) 72
PkrI GCNGC 1 cut(s) 361
PleI GAGTC 2 cut(s) 12, 389
PmaCI CACGTG 1 cut(s) 489
PmlI CACGTG 1 cut(s) 489
PpsI GAGTC 2 cut(s) 12, 389
Ppu21I YACGTR 1 cut(s) 489
PspCI CACGTG 1 cut(s) 489
PstNI CAGNNNCTG 1 cut(s) 33
PvuII CAGCTG 1 cut(s) 359
SaqAI TTAA 2 cut(s) 86, 129
SatI GCNGC 1 cut(s) 360
Sau3AI GATC 3 cut(s) 124, 169, 190
SchI GAGTC 2 cut(s) 13, 389
SetI ASST 9 cut(s) 72, 109, 135, 151, 160, 218, 361, 486, 491
SfaNI GCATC 3 cut(s) 39, 238, 389
SmlI CTYRAG 1 cut(s) 128
SmoI CTYRAG 1 cut(s) 128
Sse9I AATT 4 cut(s) 135, 248, 374, 416
SspMI CTAG 5 cut(s) 60, 108, 198, 264, 431
TaaI ACNGT 1 cut(s) 479
TaiI ACGT 2 cut(s) 486, 491
TasI AATT 4 cut(s) 135, 248, 374, 416
Tru1I TTAA 2 cut(s) 86, 129
Tru9I TTAA 2 cut(s) 86, 129
TscAI CASTG 1 cut(s) 352
TseFI GTSAC 1 cut(s) 484
TseI GCWGC 1 cut(s) 359
Tsp45I GTSAC 1 cut(s) 484
TspDTI ATGAA 2 cut(s) 89, 387
TspRI CASTG 1 cut(s) 352
Vha464I CTTAAG 1 cut(s) 128
XagI CCTNNNNNAGG 1 cut(s) 153
XapI RAATTY 3 cut(s) 248, 374, 416
XbaI TCTAGA 1 cut(s) 263
XspI CTAG 5 cut(s) 60, 108, 198, 264, 431
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.