pycom1094g00010

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00001094
OG0000562
Physical Location & Seq
Forward (+)
4058 .. 4624
567 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom1094g00010.1

Sequence Viewer

Length: 468 bp
ATGTCATGGCTCCTAAATTCCATGGAGCGTAAACTAGCTGAAATATTCAGTTATTCTGAATCATCATTCGAGCTATGGGAGACAGCCAAGGAGATCATGAAGAGCATGTGGAATGAGTTGGAAATGTATCGGCCTCATACAACTGAAGCGTCCGTGCTACTGAAAAGGGCAGAAGAAGACAAGATATTCCAACTCTTGTCAAGCCTCGATTCAGGATACGAAGACCTACAAAGCCACATACTCATGAACCCCGAACTACCTTCCTTCACCAGTGTATGTGCAACAATCCAACGTGAAGAAGTACGAAGGAAAGTCATGAACATTGGCACAAAGACCAATGTAACTGAAGCAAGGTCTTACCTAACCAACGAAAGAAAATACAAAGTGAAGAATCCACACTTGAAGTGCCAACATTGCAACTATACTGGCCATGTTAAGGAGACATGCTGGATTTTACATCAGAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_2 Retrotran_gag_2 Retrotran_gag_3 Retrotrans_gag gag_pre-integrs rve

Protein Analysis

156

Amino Acids

18.31

Weight (kDa)

6.6

Isoelectric Point (pI)

51.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 427
AcsI RAATTY 1 cut(s) 16
AcuI CTGAAG 2 cut(s) 165, 366
AfaI GTAC 1 cut(s) 303
AfiI CCNNNNNNNGG 1 cut(s) 436
AgsI TTSAA 1 cut(s) 403
AluBI AGCT 2 cut(s) 38, 73
AluI AGCT 2 cut(s) 38, 73
Alw26I GTCTC 2 cut(s) 74, 434
AoxI GGCC 2 cut(s) 131, 427
ApoI RAATTY 1 cut(s) 16
AsuHPI GGTGA 1 cut(s) 259
BalI TGGCCA 1 cut(s) 429
BbsI GAAGAC 2 cut(s) 183, 228
BciVI GTATCC 1 cut(s) 209
BcoDI GTCTC 2 cut(s) 74, 434
BfaI CTAG 1 cut(s) 35
BfuI GTATCC 1 cut(s) 209
BmiI GGNNCC 1 cut(s) 11
BpiI GAAGAC 2 cut(s) 183, 228
BsaJI CCNNGG 2 cut(s) 21, 87
Bsc4I CCNNNNNNNGG 1 cut(s) 436
Bse1I ACTGG 2 cut(s) 270, 430
Bse3DI GCAATG 1 cut(s) 412
BseDI CCNNGG 2 cut(s) 21, 87
BseLI CCNNNNNNNGG 1 cut(s) 436
BseMI GCAATG 1 cut(s) 412
BseNI ACTGG 2 cut(s) 270, 430
BshFI GGCC 2 cut(s) 133, 429
BslI CCNNNNNNNGG 1 cut(s) 436
BsmAI GTCTC 2 cut(s) 74, 434
BsnI GGCC 2 cut(s) 133, 429
Bsp143I GATC 1 cut(s) 93
Bsp19I CCATGG 1 cut(s) 21
BspANI GGCC 2 cut(s) 133, 429
BspHI TCATGA 3 cut(s) 96, 243, 315
BspLI GGNNCC 1 cut(s) 11
BspQI GCTCTTC 1 cut(s) 95
BsrDI GCAATG 1 cut(s) 412
BsrI ACTGG 2 cut(s) 270, 430
BssECI CCNNGG 2 cut(s) 21, 87
BssMI GATC 1 cut(s) 93
BssT1I CCWWGG 2 cut(s) 21, 87
Bst6I CTCTTC 1 cut(s) 95
BstDSI CCRYGG 1 cut(s) 21
BstKTI GATC 1 cut(s) 96
BstMAI GTCTC 2 cut(s) 74, 434
BstMBI GATC 1 cut(s) 93
BstMWI GCNNNNNNNGC 1 cut(s) 414
BstNSI RCATGY 2 cut(s) 109, 447
BstV2I GAAGAC 2 cut(s) 183, 228
BsuI GTATCC 1 cut(s) 209
BsuRI GGCC 2 cut(s) 133, 429
BtgI CCRYGG 1 cut(s) 21
BtsIMutI CAGTG 1 cut(s) 277
CciI TCATGA 3 cut(s) 96, 243, 315
CseI GACGC 1 cut(s) 138
Csp6I GTAC 1 cut(s) 302
CviAII CATG 8 cut(s) 6, 22, 97, 106, 244, 316, 431, 444
CviJI RGCY 8 cut(s) 10, 38, 73, 86, 133, 204, 234, 429
CviKI_1 RGCY 8 cut(s) 10, 38, 73, 86, 133, 204, 234, 429
CviQI GTAC 1 cut(s) 302
DpnI GATC 1 cut(s) 95
DpnII GATC 1 cut(s) 93
EaeI YGGCCR 1 cut(s) 427
Eam1104I CTCTTC 1 cut(s) 95
EarI CTCTTC 1 cut(s) 95
Eco130I CCWWGG 2 cut(s) 21, 87
Eco57I CTGAAG 2 cut(s) 165, 366
EcoT14I CCWWGG 2 cut(s) 21, 87
ErhI CCWWGG 2 cut(s) 21, 87
FaeI CATG 8 cut(s) 9, 25, 100, 109, 247, 319, 434, 447
FatI CATG 8 cut(s) 5, 21, 96, 105, 243, 315, 430, 443
FspBI CTAG 1 cut(s) 35
HaeIII GGCC 2 cut(s) 133, 429
HgaI GACGC 1 cut(s) 138
Hin1II CATG 8 cut(s) 9, 25, 100, 109, 247, 319, 434, 447
HinfI GANTC 3 cut(s) 59, 209, 391
HphI GGTGA 1 cut(s) 259
Hpy166II GTNNAC 1 cut(s) 32
Hpy188I TCNGA 2 cut(s) 58, 462
Hpy188III TCNNGA 4 cut(s) 97, 213, 244, 316
Hpy8I GTNNAC 1 cut(s) 32
HpyAV CCTTC 3 cut(s) 270, 274, 300
HpyCH4IV ACGT 1 cut(s) 292
HpyCH4V TGCA 2 cut(s) 281, 417
HpyF10VI GCNNNNNNNGC 1 cut(s) 414
HpySE526I ACGT 1 cut(s) 292
Hsp92II CATG 8 cut(s) 9, 25, 100, 109, 247, 319, 434, 447
Kzo9I GATC 1 cut(s) 93
LguI GCTCTTC 1 cut(s) 95
LmnI GCTCC 2 cut(s) 15, 25
LpnPI CCDG 4 cut(s) 198, 283, 411, 433
MaeI CTAG 1 cut(s) 35
MaeII ACGT 1 cut(s) 292
MaeIII GTNAC 1 cut(s) 340
MalI GATC 1 cut(s) 95
MboI GATC 1 cut(s) 93
MboII GAAGA 6 cut(s) 112, 185, 188, 233, 308, 400
MlsI TGGCCA 1 cut(s) 429
MluCI AATT 2 cut(s) 16, 463
MluNI TGGCCA 1 cut(s) 429
MmeI TCCRAC 3 cut(s) 99, 214, 313
MnlI CCTC 2 cut(s) 144, 215
Mox20I TGGCCA 1 cut(s) 429
MscI TGGCCA 1 cut(s) 429
MseI TTAA 2 cut(s) 435, 466
MslI CAYNNNNRTG 1 cut(s) 242
Msp20I TGGCCA 1 cut(s) 429
MwoI GCNNNNNNNGC 1 cut(s) 414
NcoI CCATGG 1 cut(s) 21
NdeII GATC 1 cut(s) 93
NlaIII CATG 8 cut(s) 9, 25, 100, 109, 247, 319, 434, 447
NlaIV GGNNCC 1 cut(s) 11
NspI RCATGY 2 cut(s) 109, 447
PagI TCATGA 3 cut(s) 96, 243, 315
PciSI GCTCTTC 1 cut(s) 95
PfeI GAWTC 3 cut(s) 59, 209, 391
PspN4I GGNNCC 1 cut(s) 11
RsaI GTAC 1 cut(s) 303
RsaNI GTAC 1 cut(s) 302
RseI CAYNNNNRTG 1 cut(s) 242
SapI GCTCTTC 1 cut(s) 95
SaqAI TTAA 2 cut(s) 435, 466
Sau3AI GATC 1 cut(s) 93
SetI ASST 7 cut(s) 40, 75, 228, 262, 295, 356, 363
SmiMI CAYNNNNRTG 1 cut(s) 242
Sse9I AATT 2 cut(s) 16, 463
SspI AATATT 1 cut(s) 45
SspMI CTAG 1 cut(s) 35
StyI CCWWGG 2 cut(s) 21, 87
TaiI ACGT 1 cut(s) 295
TaqI TCGA 2 cut(s) 69, 207
TasI AATT 2 cut(s) 16, 463
TfiI GAWTC 3 cut(s) 59, 209, 391
Tru1I TTAA 2 cut(s) 435, 466
Tru9I TTAA 2 cut(s) 435, 466
TscAI CASTG 1 cut(s) 277
TspDTI ATGAA 3 cut(s) 113, 260, 332
TspGWI ACGGA 1 cut(s) 142
TspRI CASTG 1 cut(s) 277
XapI RAATTY 1 cut(s) 16
XceI RCATGY 2 cut(s) 109, 447
XspI CTAG 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.