Rw4G001540

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
OG0000562
Physical Location & Seq
Forward (+)
2859825 .. 2860612
788 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G001540.1

Sequence Viewer

Length: 462 bp
ATGAATGAAGACTTAAAGACATCTGTTTCTGAAGCTAGAGCTTTTGCAAGTGATCATAAGCCAGCTGAGAAGAAACCTTACAGAGGTAAACGCCCTGATCTTCACTGTACTTACTGTGATCATCCTGGACATCTCAGAGACAGGTGCTGGATACTGCATCCAGAACTCAAACCCAAGTTTGATAAGCAAGCCAGAGATACCAGGTTCTTTCCAAAAAATCATGGTCACAAGGCAAATCATGTGGCTTCTGCTACTGAGGGATTACTAAACTTCACTGCAAATCCAGCTGCACTGATAAATGAATTTGCAGCCTACATCAAATTGAAGCAAGGAAATGAAAAAGAGGCTGTTACTGAAGACTCAACAGCTTTACTTGGAAAATTCGCTGGTTTTCTAGCAGAGGCAGATGGAATAACTCAACATGATGTGTCAGGATCTAGCCACCAAGGAGCAGATTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 Retrotran_gag_3 Retrotrans_gag rve

Protein Analysis

153

Amino Acids

17.04

Weight (kDa)

7.16

Isoelectric Point (pI)

25.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 442
AcsI RAATTY 2 cut(s) 302, 380
AcuI CTGAAG 2 cut(s) 51, 375
AfaI GTAC 1 cut(s) 109
AfiI CCNNNNNNNGG 1 cut(s) 83
AgsI TTSAA 1 cut(s) 325
AjnI CCWGG 2 cut(s) 124, 200
AluBI AGCT 5 cut(s) 35, 41, 65, 287, 368
AluI AGCT 5 cut(s) 35, 41, 65, 287, 368
Alw26I GTCTC 1 cut(s) 132
AlwI GGATC 1 cut(s) 442
AlwNI CAGNNNCTG 1 cut(s) 147
ApeKI GCWGC 2 cut(s) 287, 308
ApoI RAATTY 2 cut(s) 302, 380
BarI GAAGNNNNNNTAC 2 cut(s) 62, 94
BbsI GAAGAC 2 cut(s) 15, 363
BbvI GCAGC 2 cut(s) 274, 320
BccI CCATC 1 cut(s) 401
BciT130I CCWGG 2 cut(s) 126, 202
BciVI GTATCC 1 cut(s) 144
BclI TGATCA 2 cut(s) 52, 118
BcoDI GTCTC 1 cut(s) 132
BfaI CTAG 3 cut(s) 36, 395, 438
BfuI GTATCC 1 cut(s) 144
BisI GCNGC 2 cut(s) 288, 309
BlsI GCNGC 2 cut(s) 289, 310
Bme1390I CCNGG 2 cut(s) 126, 202
BmrFI CCNGG 2 cut(s) 126, 202
BmsI GCATC 1 cut(s) 166
BpiI GAAGAC 2 cut(s) 15, 363
BsaJI CCNNGG 1 cut(s) 445
Bsc4I CCNNNNNNNGG 1 cut(s) 83
BseBI CCWGG 2 cut(s) 126, 202
BseDI CCNNGG 1 cut(s) 445
BseGI GGATG 2 cut(s) 121, 157
BseLI CCNNNNNNNGG 1 cut(s) 83
BseMII CTCAG 3 cut(s) 57, 148, 246
BseXI GCAGC 2 cut(s) 274, 320
BsgI GTGCAG 1 cut(s) 273
BslI CCNNNNNNNGG 1 cut(s) 83
BsmAI GTCTC 1 cut(s) 132
Bsp143I GATC 4 cut(s) 52, 97, 118, 434
BspCNI CTCAG 3 cut(s) 58, 147, 247
BspPI GGATC 1 cut(s) 442
BssECI CCNNGG 1 cut(s) 445
BssMI GATC 4 cut(s) 52, 97, 118, 434
BssT1I CCWWGG 1 cut(s) 445
Bst2UI CCWGG 2 cut(s) 126, 202
Bst4CI ACNGT 2 cut(s) 107, 116
BstC8I GCNNGC 2 cut(s) 63, 189
BstDEI CTNAG 3 cut(s) 66, 134, 255
BstENI CCTNNNNNAGG 1 cut(s) 81
BstF5I GGATG 2 cut(s) 121, 157
BstKTI GATC 4 cut(s) 55, 100, 121, 437
BstMAI GTCTC 1 cut(s) 132
BstMBI GATC 4 cut(s) 52, 97, 118, 434
BstMWI GCNNNNNNNGC 1 cut(s) 284
BstNI CCWGG 2 cut(s) 126, 202
BstSCI CCNGG 2 cut(s) 124, 200
BstV1I GCAGC 2 cut(s) 274, 320
BstV2I GAAGAC 2 cut(s) 15, 363
BstX2I RGATCY 1 cut(s) 434
BstYI RGATCY 1 cut(s) 434
BsuI GTATCC 1 cut(s) 144
BtsCI GGATG 2 cut(s) 121, 157
BtsI GCAGTG 1 cut(s) 273
BtsIMutI CAGTG 3 cut(s) 103, 273, 290
Cac8I GCNNGC 2 cut(s) 63, 189
CaiI CAGNNNCTG 1 cut(s) 147
CsiI ACCWGGT 1 cut(s) 200
Csp6I GTAC 1 cut(s) 108
CspCI CAANNNNNGTGG 2 cut(s) 222, 257
CviAII CATG 3 cut(s) 221, 239, 422
CviQI GTAC 1 cut(s) 108
DdeI CTNAG 3 cut(s) 66, 134, 255
DpnI GATC 4 cut(s) 54, 99, 120, 436
DpnII GATC 4 cut(s) 52, 97, 118, 434
Eco130I CCWWGG 1 cut(s) 445
Eco57I CTGAAG 2 cut(s) 51, 375
EcoNI CCTNNNNNAGG 1 cut(s) 81
EcoRII CCWGG 2 cut(s) 124, 200
EcoT14I CCWWGG 1 cut(s) 445
ErhI CCWWGG 1 cut(s) 445
FaeI CATG 3 cut(s) 224, 242, 425
FaiI YATR 4 cut(s) 57, 222, 240, 423
FatI CATG 3 cut(s) 220, 238, 421
FbaI TGATCA 2 cut(s) 52, 118
Fnu4HI GCNGC 2 cut(s) 288, 309
FokI GGATG 2 cut(s) 108, 144
Fsp4HI GCNGC 2 cut(s) 288, 309
FspBI CTAG 3 cut(s) 36, 395, 438
GluI GCNGC 2 cut(s) 288, 309
Hin1II CATG 3 cut(s) 224, 242, 425
HinfI GANTC 1 cut(s) 359
Hpy166II GTNNAC 1 cut(s) 89
Hpy188I TCNGA 2 cut(s) 31, 137
Hpy188III TCNNGA 2 cut(s) 161, 432
Hpy8I GTNNAC 1 cut(s) 89
HpyCH4III ACNGT 2 cut(s) 107, 116
HpyCH4V TGCA 5 cut(s) 47, 157, 278, 290, 308
HpyF10VI GCNNNNNNNGC 1 cut(s) 284
HpyF3I CTNAG 3 cut(s) 66, 134, 255
Hsp92II CATG 3 cut(s) 224, 242, 425
Ksp22I TGATCA 2 cut(s) 52, 118
Kzo9I GATC 4 cut(s) 52, 97, 118, 434
LmnI GCTCC 1 cut(s) 449
Lsp1109I GCAGC 2 cut(s) 274, 320
LweI GCATC 1 cut(s) 166
MabI ACCWGGT 1 cut(s) 200
MaeI CTAG 3 cut(s) 36, 395, 438
MaeIII GTNAC 2 cut(s) 224, 349
MalI GATC 4 cut(s) 54, 99, 120, 436
MboI GATC 4 cut(s) 52, 97, 118, 434
MboII GAAGA 4 cut(s) 20, 82, 92, 368
MflI RGATCY 1 cut(s) 434
MluCI AATT 3 cut(s) 302, 320, 380
MlyI GAGTC 1 cut(s) 353
MnlI CCTC 4 cut(s) 77, 250, 337, 394
MseI TTAA 1 cut(s) 14
MspA1I CMGCKG 2 cut(s) 65, 287
MspR9I CCNGG 2 cut(s) 126, 202
MvaI CCWGG 2 cut(s) 126, 202
MwoI GCNNNNNNNGC 1 cut(s) 284
NdeII GATC 4 cut(s) 52, 97, 118, 434
NlaIII CATG 3 cut(s) 224, 242, 425
NmuCI GTSAC 1 cut(s) 224
PfoI TCCNGGA 1 cut(s) 124
PkrI GCNGC 2 cut(s) 289, 310
PleI GAGTC 1 cut(s) 353
PpsI GAGTC 1 cut(s) 353
Psp6I CCWGG 2 cut(s) 124, 200
PspGI CCWGG 2 cut(s) 124, 200
PstNI CAGNNNCTG 1 cut(s) 147
PsuI RGATCY 1 cut(s) 434
PvuII CAGCTG 2 cut(s) 65, 287
RsaI GTAC 1 cut(s) 109
RsaNI GTAC 1 cut(s) 108
SaqAI TTAA 1 cut(s) 14
SatI GCNGC 2 cut(s) 288, 309
Sau3AI GATC 4 cut(s) 52, 97, 118, 434
SchI GAGTC 1 cut(s) 353
ScrFI CCNGG 2 cut(s) 126, 202
SetI ASST 9 cut(s) 37, 43, 67, 79, 88, 146, 206, 289, 370
SexAI ACCWGGT 1 cut(s) 200
SfaNI GCATC 1 cut(s) 166
Sse9I AATT 3 cut(s) 302, 320, 380
SspMI CTAG 3 cut(s) 36, 395, 438
StyD4I CCNGG 2 cut(s) 124, 200
StyI CCWWGG 1 cut(s) 445
TaaI ACNGT 2 cut(s) 107, 116
TasI AATT 3 cut(s) 302, 320, 380
TatI WGTACW 1 cut(s) 107
Tru1I TTAA 1 cut(s) 14
Tru9I TTAA 1 cut(s) 14
TscAI CASTG 3 cut(s) 110, 280, 297
TseFI GTSAC 1 cut(s) 224
TseI GCWGC 2 cut(s) 287, 308
Tsp45I GTSAC 1 cut(s) 224
TspDTI ATGAA 4 cut(s) 17, 21, 315, 351
TspRI CASTG 3 cut(s) 110, 280, 297
XagI CCTNNNNNAGG 1 cut(s) 81
XapI RAATTY 2 cut(s) 302, 380
XspI CTAG 3 cut(s) 36, 395, 438
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.