Rmu_sc0004191.1_g000036

gag-polypeptide of LTR copia-type

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004191.1
OG0000562
Physical Location & Seq
Reverse (-)
141148 .. 141635
488 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004191.1_g000036.1.cds

Sequence Viewer

Length: 279 bp
atggagccaaagcttgctgaaatcttcagctattcggagtcatctcaacatctctgggatactgtcaaagacatgtatggcaacctagacaatgcagcaagagtgttccaactcaaaaaggatcttgcagggattcaacaagtatgcaactccattcaacgtgcagaagtgcacaaaaaggtgatgaatatggacaacagagctggaggatcagaagctagagcatttgctgcaaacaaaagtgtcacaagcgacagaacgtggatgtggatgacttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00940 ko01110 map00940 map01110
Pfam Domains
Protein Families
Retrotran_gag_2

Protein Analysis

92

Amino Acids

10.49

Weight (kDa)

7.89

Isoelectric Point (pI)

31.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 129, 217
AcuI CTGAAG 1 cut(s) 10
AflIII ACRYGT 1 cut(s) 72
AgsI TTSAA 2 cut(s) 137, 158
AluBI AGCT 4 cut(s) 13, 30, 203, 218
AluI AGCT 4 cut(s) 13, 30, 203, 218
Alw21I GWGCWC 1 cut(s) 174
Alw44I GTGCAC 1 cut(s) 170
AlwI GGATC 2 cut(s) 129, 217
ApaLI GTGCAC 1 cut(s) 170
ApeKI GCWGC 2 cut(s) 95, 230
AsuHPI GGTGA 1 cut(s) 193
BaeGI GKGCMC 1 cut(s) 174
Bbv12I GWGCWC 1 cut(s) 174
BbvI GCAGC 2 cut(s) 107, 217
BciVI GTATCC 1 cut(s) 52
BfaI CTAG 2 cut(s) 86, 219
BfuI GTATCC 1 cut(s) 52
BisI GCNGC 2 cut(s) 96, 231
BlsI GCNGC 2 cut(s) 97, 232
BmiI GGNNCC 1 cut(s) 6
BpmI CTGGAG 1 cut(s) 225
BseGI GGATG 2 cut(s) 270, 276
BseSI GKGCMC 1 cut(s) 174
BseXI GCAGC 2 cut(s) 107, 217
BsgI GTGCAG 1 cut(s) 183
BsiHKAI GWGCWC 1 cut(s) 174
Bsp1286I GDGCHC 1 cut(s) 174
Bsp143I GATC 2 cut(s) 121, 209
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 2 cut(s) 129, 217
BssMI GATC 2 cut(s) 121, 209
Bst4CI ACNGT 1 cut(s) 64
BstAPI GCANNNNNTGC 1 cut(s) 230
BstC8I GCNNGC 1 cut(s) 15
BstF5I GGATG 2 cut(s) 270, 276
BstKTI GATC 2 cut(s) 124, 212
BstMBI GATC 2 cut(s) 121, 209
BstMWI GCNNNNNNNGC 1 cut(s) 230
BstNSI RCATGY 1 cut(s) 76
BstSLI GKGCMC 1 cut(s) 174
BstV1I GCAGC 2 cut(s) 107, 217
BstX2I RGATCY 1 cut(s) 121
BstYI RGATCY 1 cut(s) 121
BsuI GTATCC 1 cut(s) 52
BtsCI GGATG 2 cut(s) 270, 276
Cac8I GCNNGC 1 cut(s) 15
CviAII CATG 1 cut(s) 73
CviJI RGCY 5 cut(s) 7, 13, 30, 203, 218
CviKI_1 RGCY 5 cut(s) 7, 13, 30, 203, 218
DpnI GATC 2 cut(s) 123, 211
DpnII GATC 2 cut(s) 121, 209
Eco57I CTGAAG 1 cut(s) 10
FaeI CATG 1 cut(s) 76
FaiI YATR 4 cut(s) 74, 78, 145, 191
FatI CATG 1 cut(s) 72
Fnu4HI GCNGC 2 cut(s) 96, 231
Fsp4HI GCNGC 2 cut(s) 96, 231
FspBI CTAG 2 cut(s) 86, 219
GluI GCNGC 2 cut(s) 96, 231
GsuI CTGGAG 1 cut(s) 225
Hin1II CATG 1 cut(s) 76
HindIII AAGCTT 1 cut(s) 11
HinfI GANTC 2 cut(s) 38, 133
HphI GGTGA 1 cut(s) 193
Hpy166II GTNNAC 1 cut(s) 172
Hpy188I TCNGA 2 cut(s) 37, 214
Hpy8I GTNNAC 1 cut(s) 172
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4IV ACGT 2 cut(s) 160, 260
HpyCH4V TGCA 6 cut(s) 95, 128, 147, 164, 172, 233
HpyF10VI GCNNNNNNNGC 1 cut(s) 230
HpySE526I ACGT 2 cut(s) 160, 260
Hsp92II CATG 1 cut(s) 76
Kzo9I GATC 2 cut(s) 121, 209
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 3 cut(s) 40, 114, 189
Lsp1109I GCAGC 2 cut(s) 107, 217
MaeI CTAG 2 cut(s) 86, 219
MaeII ACGT 2 cut(s) 160, 260
MaeIII GTNAC 1 cut(s) 244
MalI GATC 2 cut(s) 123, 211
MboI GATC 2 cut(s) 121, 209
MboII GAAGA 1 cut(s) 16
MflI RGATCY 1 cut(s) 121
MhlI GDGCHC 1 cut(s) 174
MlyI GAGTC 1 cut(s) 47
MmeI TCCRAC 1 cut(s) 133
MnlI CCTC 1 cut(s) 200
MseI TTAA 1 cut(s) 277
MwoI GCNNNNNNNGC 1 cut(s) 230
NdeII GATC 2 cut(s) 121, 209
NlaIII CATG 1 cut(s) 76
NlaIV GGNNCC 1 cut(s) 6
NmuCI GTSAC 1 cut(s) 244
NspI RCATGY 1 cut(s) 76
PciI ACATGT 1 cut(s) 72
PfeI GAWTC 1 cut(s) 133
PkrI GCNGC 2 cut(s) 97, 232
PleI GAGTC 1 cut(s) 46
PpsI GAGTC 1 cut(s) 46
PscI ACATGT 1 cut(s) 72
PspN4I GGNNCC 1 cut(s) 6
PsuI RGATCY 1 cut(s) 121
SaqAI TTAA 1 cut(s) 277
SatI GCNGC 2 cut(s) 96, 231
Sau3AI GATC 2 cut(s) 121, 209
SchI GAGTC 1 cut(s) 47
SduI GDGCHC 1 cut(s) 174
SetI ASST 8 cut(s) 15, 32, 87, 163, 183, 205, 220, 263
SspMI CTAG 2 cut(s) 86, 219
TaaI ACNGT 1 cut(s) 64
TaiI ACGT 2 cut(s) 163, 263
TfiI GAWTC 1 cut(s) 133
Tru1I TTAA 1 cut(s) 277
Tru9I TTAA 1 cut(s) 277
TseFI GTSAC 1 cut(s) 244
TseI GCWGC 2 cut(s) 95, 230
Tsp45I GTSAC 1 cut(s) 244
TspDTI ATGAA 1 cut(s) 200
VneI GTGCAC 1 cut(s) 170
XceI RCATGY 1 cut(s) 76
XspI CTAG 2 cut(s) 86, 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.