FvH4_3g36541

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
OG0000562
Physical Location & Seq
Reverse (-)
31298667 .. 31299032
366 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g36541.t1

Sequence Viewer

Length: 366 bp
ATGGCAGAGGAACAAGATTATTCTATTTCTCCATCTGTTTCTACAATTGTCTCAACTGAGGCTGAAGGTAATCCTAATCTTTGTCTCACATCTGTCTTACTCAATGAGTTCAACTATTTGTCTTGGTCAAGAGCTATATCTCTTGCACTTGGAGGGAAATCAAAGCTTGGACACATAAATGGAAGTGTTCAACCTCTTGAGCAACTCACTCCCACATTTGAGGTTTGGCTTGCCAAAGATCTGCTCGTTATGTCTTGGCTTCTCAACTCCATGGAACCTGCTATCTCTGATATTTTTAGTTTCTCAGAATTAGCCCTGGATCTTTGGAAGGTTGTAGAAGAGATGTATAGAAATCAAATTGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_2 Retrotran_gag_2 Retrotran_gag_3 Retrotrans_gag gag_pre-integrs rve

Protein Analysis

122

Amino Acids

13.51

Weight (kDa)

4.3

Isoelectric Point (pI)

46.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotran_gag_3 PF14244 23 - 64 7.9e-15 gag-polypeptide of LTR copia-type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 286
AclWI GGATC 1 cut(s) 327
AcuI CTGAAG 1 cut(s) 84
AgsI TTSAA 2 cut(s) 112, 191
AjnI CCWGG 1 cut(s) 315
AluBI AGCT 2 cut(s) 134, 166
AluI AGCT 2 cut(s) 134, 166
Alw26I GTCTC 2 cut(s) 55, 89
AlwI GGATC 1 cut(s) 327
BccI CCATC 1 cut(s) 40
BciT130I CCWGG 1 cut(s) 317
BcoDI GTCTC 2 cut(s) 55, 89
BfuAI ACCTGC 1 cut(s) 286
BglII AGATCT 1 cut(s) 238
Bme1390I CCNGG 1 cut(s) 317
BmiI GGNNCC 1 cut(s) 276
BmrFI CCNGG 1 cut(s) 317
BpuEI CTTGAG 1 cut(s) 218
BsaJI CCNNGG 2 cut(s) 270, 315
BseBI CCWGG 1 cut(s) 317
BseDI CCNNGG 2 cut(s) 270, 315
BseMII CTCAG 2 cut(s) 48, 318
BsmAI GTCTC 2 cut(s) 55, 89
Bsp143I GATC 2 cut(s) 238, 319
Bsp19I CCATGG 1 cut(s) 270
BspCNI CTCAG 2 cut(s) 49, 317
BspLI GGNNCC 1 cut(s) 276
BspMI ACCTGC 1 cut(s) 286
BspPI GGATC 1 cut(s) 327
BssECI CCNNGG 2 cut(s) 270, 315
BssMI GATC 2 cut(s) 238, 319
BssT1I CCWWGG 1 cut(s) 270
Bst2UI CCWGG 1 cut(s) 317
Bst6I CTCTTC 1 cut(s) 333
BstC8I GCNNGC 1 cut(s) 231
BstDEI CTNAG 2 cut(s) 57, 304
BstDSI CCRYGG 1 cut(s) 270
BstKTI GATC 2 cut(s) 241, 322
BstMAI GTCTC 2 cut(s) 55, 89
BstMBI GATC 2 cut(s) 238, 319
BstNI CCWGG 1 cut(s) 317
BstSCI CCNGG 1 cut(s) 315
BstX2I RGATCY 2 cut(s) 238, 319
BstYI RGATCY 2 cut(s) 238, 319
BtgI CCRYGG 1 cut(s) 270
BveI ACCTGC 1 cut(s) 286
Cac8I GCNNGC 1 cut(s) 231
CviAII CATG 1 cut(s) 271
CviJI RGCY 6 cut(s) 62, 134, 166, 229, 259, 314
CviKI_1 RGCY 6 cut(s) 62, 134, 166, 229, 259, 314
DdeI CTNAG 2 cut(s) 57, 304
DpnI GATC 2 cut(s) 240, 321
DpnII GATC 2 cut(s) 238, 319
Eam1104I CTCTTC 1 cut(s) 333
EarI CTCTTC 1 cut(s) 333
Eco130I CCWWGG 1 cut(s) 270
Eco57I CTGAAG 1 cut(s) 84
EcoRII CCWGG 1 cut(s) 315
EcoT14I CCWWGG 1 cut(s) 270
ErhI CCWWGG 1 cut(s) 270
FaeI CATG 1 cut(s) 274
FaiI YATR 5 cut(s) 137, 176, 251, 272, 348
FatI CATG 1 cut(s) 270
Hin1II CATG 1 cut(s) 274
HindIII AAGCTT 1 cut(s) 164
Hpy188I TCNGA 2 cut(s) 289, 307
Hpy188III TCNNGA 2 cut(s) 129, 197
HpyAV CCTTC 2 cut(s) 59, 322
HpyCH4V TGCA 1 cut(s) 146
HpyF3I CTNAG 2 cut(s) 57, 304
Hsp92II CATG 1 cut(s) 274
Kzo9I GATC 2 cut(s) 238, 319
LpnPI CCDG 3 cut(s) 291, 302, 329
MalI GATC 2 cut(s) 240, 321
MboI GATC 2 cut(s) 238, 319
MboII GAAGA 1 cut(s) 350
MfeI CAATTG 1 cut(s) 45
MflI RGATCY 2 cut(s) 238, 319
MluCI AATT 3 cut(s) 45, 308, 357
MnlI CCTC 4 cut(s) 52, 146, 204, 214
MslI CAYNNNNRTG 1 cut(s) 177
MspR9I CCNGG 1 cut(s) 317
MunI CAATTG 1 cut(s) 45
MvaI CCWGG 1 cut(s) 317
NcoI CCATGG 1 cut(s) 270
NdeII GATC 2 cut(s) 238, 319
NlaIII CATG 1 cut(s) 274
NlaIV GGNNCC 1 cut(s) 276
Psp6I CCWGG 1 cut(s) 315
PspGI CCWGG 1 cut(s) 315
PspN4I GGNNCC 1 cut(s) 276
PsuI RGATCY 2 cut(s) 238, 319
RseI CAYNNNNRTG 1 cut(s) 177
Sau3AI GATC 2 cut(s) 238, 319
ScrFI CCNGG 1 cut(s) 317
SetI ASST 7 cut(s) 70, 136, 168, 196, 225, 280, 333
SmiMI CAYNNNNRTG 1 cut(s) 177
SmlI CTYRAG 1 cut(s) 197
SmoI CTYRAG 1 cut(s) 197
Sse9I AATT 3 cut(s) 45, 308, 357
StyD4I CCNGG 1 cut(s) 315
StyI CCWWGG 1 cut(s) 270
TasI AATT 3 cut(s) 45, 308, 357
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.