Rmu_sc0005670.1_g000006

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005670.1
Physical Location & Seq
Reverse (-)
15342 .. 15659
318 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005670.1_g000006.1.cds

Sequence Viewer

Length: 318 bp
atggaggctaagattgttgaaattttcaactactcggaatcatccatgcatctctggaagcatgtcaaggagatgtatggaaaccaaaacaactcaactcatgtttttcaactcaagaaagacattgttggtctccaacaagaggaaaaggcatttgttcaataccttggaggcccaaccattatgtggaatgagttagatgtatatcgaactcacaccatggatgctaatgtcctattgaagaggggtgaagaagacaagattttccatcttcttgctaatctgagctcagaatatgaagacttgagaagcttatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

12.36

Weight (kDa)

5.46

Isoelectric Point (pI)

43.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 186
AcsI RAATTY 1 cut(s) 21
AfiI CCNNNNNNNGG 2 cut(s) 142, 186
AgsI TTSAA 5 cut(s) 20, 28, 110, 161, 241
AluBI AGCT 2 cut(s) 288, 312
AluI AGCT 2 cut(s) 288, 312
Alw21I GWGCWC 1 cut(s) 290
Alw26I GTCTC 1 cut(s) 137
AoxI GGCC 1 cut(s) 172
ApoI RAATTY 1 cut(s) 21
AspS9I GGNCC 1 cut(s) 173
AsuHPI GGTGA 1 cut(s) 260
BanII GRGCYC 1 cut(s) 290
BbsI GAAGAC 2 cut(s) 261, 306
Bbv12I GWGCWC 1 cut(s) 290
BccI CCATC 1 cut(s) 276
BcoDI GTCTC 1 cut(s) 137
BmgT120I GGNCC 1 cut(s) 173
BmsI GCATC 2 cut(s) 58, 214
BpiI GAAGAC 2 cut(s) 261, 306
BpuEI CTTGAG 1 cut(s) 98
BsaBI GATNNNNATC 1 cut(s) 204
BsaI GGTCTC 1 cut(s) 137
BsaJI CCNNGG 2 cut(s) 166, 219
Bsc4I CCNNNNNNNGG 2 cut(s) 142, 186
Bse8I GATNNNNATC 1 cut(s) 204
BseDI CCNNGG 2 cut(s) 166, 219
BseGI GGATG 2 cut(s) 41, 229
BseJI GATNNNNATC 1 cut(s) 204
BseLI CCNNNNNNNGG 2 cut(s) 142, 186
BseMII CTCAG 2 cut(s) 275, 303
BshFI GGCC 1 cut(s) 174
BsiHKAI GWGCWC 1 cut(s) 290
BslI CCNNNNNNNGG 2 cut(s) 142, 186
BsmAI GTCTC 1 cut(s) 137
BsnI GGCC 1 cut(s) 174
Bso31I GGTCTC 1 cut(s) 137
Bsp1286I GDGCHC 1 cut(s) 290
Bsp19I CCATGG 1 cut(s) 219
BspANI GGCC 1 cut(s) 174
BspCNI CTCAG 2 cut(s) 276, 302
BspTNI GGTCTC 1 cut(s) 137
BssECI CCNNGG 2 cut(s) 166, 219
BssT1I CCWWGG 2 cut(s) 166, 219
Bst6I CTCTTC 1 cut(s) 236
BstDEI CTNAG 3 cut(s) 9, 284, 289
BstDSI CCRYGG 1 cut(s) 219
BstF5I GGATG 2 cut(s) 41, 229
BstMAI GTCTC 1 cut(s) 137
BstNSI RCATGY 1 cut(s) 65
BstV2I GAAGAC 2 cut(s) 261, 306
BsuRI GGCC 1 cut(s) 174
BtgI CCRYGG 1 cut(s) 219
BtsCI GGATG 2 cut(s) 41, 229
Cfr13I GGNCC 1 cut(s) 173
CviAII CATG 4 cut(s) 46, 62, 101, 220
CviJI RGCY 4 cut(s) 8, 174, 288, 312
CviKI_1 RGCY 4 cut(s) 8, 174, 288, 312
DdeI CTNAG 3 cut(s) 9, 284, 289
Eam1104I CTCTTC 1 cut(s) 236
EarI CTCTTC 1 cut(s) 236
Ecl136II GAGCTC 1 cut(s) 288
Eco130I CCWWGG 2 cut(s) 166, 219
Eco24I GRGCYC 1 cut(s) 290
Eco31I GGTCTC 1 cut(s) 137
Eco53kI GAGCTC 1 cut(s) 288
EcoICRI GAGCTC 1 cut(s) 288
EcoT14I CCWWGG 2 cut(s) 166, 219
EcoT22I ATGCAT 1 cut(s) 51
EcoT38I GRGCYC 1 cut(s) 290
ErhI CCWWGG 2 cut(s) 166, 219
FaeI CATG 4 cut(s) 49, 65, 104, 223
FaiI YATR 9 cut(s) 47, 63, 78, 102, 185, 205, 221, 297, 316
FatI CATG 4 cut(s) 45, 61, 100, 219
FokI GGATG 2 cut(s) 28, 236
FriOI GRGCYC 1 cut(s) 290
HaeIII GGCC 1 cut(s) 174
Hin1II CATG 4 cut(s) 49, 65, 104, 223
HindIII AAGCTT 1 cut(s) 310
HinfI GANTC 1 cut(s) 38
HphI GGTGA 1 cut(s) 260
Hpy188I TCNGA 3 cut(s) 37, 285, 292
Hpy188III TCNNGA 2 cut(s) 55, 115
HpyCH4V TGCA 1 cut(s) 49
HpyF3I CTNAG 3 cut(s) 9, 284, 289
Hsp92II CATG 4 cut(s) 49, 65, 104, 223
LpnPI CCDG 1 cut(s) 40
LweI GCATC 2 cut(s) 58, 214
MboII GAAGA 5 cut(s) 253, 263, 263, 266, 311
MhlI GDGCHC 1 cut(s) 290
MluCI AATT 1 cut(s) 21
MmeI TCCRAC 1 cut(s) 160
MnlI CCTC 3 cut(s) 136, 164, 237
Mph1103I ATGCAT 1 cut(s) 51
NcoI CCATGG 1 cut(s) 219
NlaIII CATG 4 cut(s) 49, 65, 104, 223
NsiI ATGCAT 1 cut(s) 51
NspI RCATGY 1 cut(s) 65
PfeI GAWTC 1 cut(s) 38
PflMI CCANNNNNTGG 1 cut(s) 186
Psp124BI GAGCTC 1 cut(s) 290
PspPI GGNCC 1 cut(s) 173
SacI GAGCTC 1 cut(s) 290
Sau96I GGNCC 1 cut(s) 173
SduI GDGCHC 1 cut(s) 290
SetI ASST 3 cut(s) 168, 290, 314
SfaNI GCATC 2 cut(s) 58, 214
SmlI CTYRAG 2 cut(s) 113, 304
SmoI CTYRAG 2 cut(s) 113, 304
Sse9I AATT 1 cut(s) 21
SstI GAGCTC 1 cut(s) 290
StyI CCWWGG 2 cut(s) 166, 219
TaqI TCGA 1 cut(s) 208
TasI AATT 1 cut(s) 21
TfiI GAWTC 1 cut(s) 38
TspDTI ATGAA 1 cut(s) 312
Van91I CCANNNNNTGG 1 cut(s) 186
XapI RAATTY 1 cut(s) 21
XceI RCATGY 1 cut(s) 65
XcmI CCANNNNNNNNNTGG 1 cut(s) 183
Zsp2I ATGCAT 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.