RchiOBHm_Chr6g0261721

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0000562
Physical Location & Seq
Reverse (-)
16557421 .. 16558551
1131 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23470

Sequence Viewer

Length: 408 bp
ATGATAGAGTCTACAAATGATAGAGTCTACAAGGGAAATTGTCCAGACTTGAAATGCAACCACTGCAGTGGCATTGGTCACACAAAGGATAGGTGCTGGATACTTCATCCAGAATTGAAGCCAAAGTTTTCGAAGGAAAACAAAAGCATCTTAAAAAACTGGAGTACCAATCCTCACAAGGCCAACCTTTCTTCCTCTTCCACCTTAGATGGGATGTTAGATTTCACTTCAAATCCAACTTCACTCATAAATGAGTTTGCTGTTTACCTTCAACAAAAGCAGAAGATGACAGAGGATACAAGTGCAACTGGAGCTGAAAATCACACTGCCTTACAAGGCAAGTTTGCAGGCTTTCTTGCTGAAACTGACAATGTGAATCAAAGTGATATTCCAGGACATCATTACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 Retrotran_gag_3 Retrotrans_gag rve

Protein Analysis

135

Amino Acids

15.07

Weight (kDa)

6.64

Isoelectric Point (pI)

32.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 11, 27
AfaI GTAC 1 cut(s) 166
AfiI CCNNNNNNNGG 1 cut(s) 210
AgsI TTSAA 4 cut(s) 52, 118, 231, 272
AjnI CCWGG 1 cut(s) 391
AleI CACNNNNGTG 1 cut(s) 66
AluBI AGCT 1 cut(s) 314
AluI AGCT 1 cut(s) 314
AoxI GGCC 1 cut(s) 180
AsuII TTCGAA 1 cut(s) 131
BaeI ACNNNNGTAYC 2 cut(s) 148, 181
BccI CCATC 1 cut(s) 203
BciT130I CCWGG 1 cut(s) 393
BciVI GTATCC 2 cut(s) 93, 289
BfmI CTRYAG 1 cut(s) 64
BfuI GTATCC 2 cut(s) 93, 289
Bme1390I CCNGG 1 cut(s) 393
BmrFI CCNGG 1 cut(s) 393
BmsI GCATC 1 cut(s) 156
BpmI CTGGAG 2 cut(s) 181, 330
Bpu14I TTCGAA 1 cut(s) 131
Bsc4I CCNNNNNNNGG 1 cut(s) 210
Bse1I ACTGG 2 cut(s) 164, 313
BseBI CCWGG 1 cut(s) 393
BseGI GGATG 2 cut(s) 106, 219
BseLI CCNNNNNNNGG 1 cut(s) 210
BseNI ACTGG 2 cut(s) 164, 313
BshFI GGCC 1 cut(s) 182
BslI CCNNNNNNNGG 1 cut(s) 210
BsnI GGCC 1 cut(s) 182
Bsp119I TTCGAA 1 cut(s) 131
BspANI GGCC 1 cut(s) 182
BspMAI CTGCAG 1 cut(s) 68
BspT104I TTCGAA 1 cut(s) 131
BsrI ACTGG 2 cut(s) 164, 313
Bst2UI CCWGG 1 cut(s) 393
Bst6I CTCTTC 1 cut(s) 202
BstAPI GCANNNNNTGC 1 cut(s) 63
BstBI TTCGAA 1 cut(s) 131
BstC8I GCNNGC 1 cut(s) 349
BstDEI CTNAG 1 cut(s) 205
BstF5I GGATG 2 cut(s) 106, 219
BstMWI GCNNNNNNNGC 2 cut(s) 63, 311
BstNI CCWGG 1 cut(s) 393
BstSCI CCNGG 1 cut(s) 391
BstSFI CTRYAG 1 cut(s) 64
BstXI CCANNNNNNTGG 1 cut(s) 68
BsuI GTATCC 2 cut(s) 93, 289
BsuRI GGCC 1 cut(s) 182
BtsCI GGATG 2 cut(s) 106, 219
BtsI GCAGTG 3 cut(s) 61, 73, 324
BtsIMutI CAGTG 3 cut(s) 61, 73, 324
Cac8I GCNNGC 1 cut(s) 349
Csp6I GTAC 1 cut(s) 165
CviJI RGCY 4 cut(s) 121, 182, 314, 351
CviKI_1 RGCY 4 cut(s) 121, 182, 314, 351
CviQI GTAC 1 cut(s) 165
DdeI CTNAG 1 cut(s) 205
Eam1104I CTCTTC 1 cut(s) 202
EarI CTCTTC 1 cut(s) 202
EcoRII CCWGG 1 cut(s) 391
FaiI YATR 1 cut(s) 248
FblI GTMKAC 2 cut(s) 11, 27
FokI GGATG 2 cut(s) 93, 226
GsuI CTGGAG 2 cut(s) 181, 330
HaeIII GGCC 1 cut(s) 182
HinfI GANTC 3 cut(s) 8, 24, 376
Hpy166II GTNNAC 3 cut(s) 12, 28, 265
Hpy188III TCNNGA 2 cut(s) 44, 110
Hpy8I GTNNAC 3 cut(s) 12, 28, 265
HpyAV CCTTC 2 cut(s) 127, 278
HpyCH4V TGCA 4 cut(s) 57, 66, 305, 347
HpyF10VI GCNNNNNNNGC 2 cut(s) 63, 311
HpyF3I CTNAG 1 cut(s) 205
LmnI GCTCC 1 cut(s) 311
LpnPI CCDG 7 cut(s) 57, 82, 123, 145, 294, 333, 378
LweI GCATC 1 cut(s) 156
MaeIII GTNAC 1 cut(s) 77
MboII GAAGA 3 cut(s) 183, 189, 295
MluCI AATT 2 cut(s) 37, 113
MlyI GAGTC 2 cut(s) 17, 33
MmeI TCCRAC 1 cut(s) 260
MnlI CCTC 3 cut(s) 183, 205, 286
MseI TTAA 1 cut(s) 152
MslI CAYNNNNRTG 1 cut(s) 66
MspR9I CCNGG 1 cut(s) 393
MvaI CCWGG 1 cut(s) 393
MwoI GCNNNNNNNGC 2 cut(s) 63, 311
NmuCI GTSAC 1 cut(s) 77
NspV TTCGAA 1 cut(s) 131
OliI CACNNNNGTG 1 cut(s) 66
PfeI GAWTC 1 cut(s) 376
PfoI TCCNGGA 1 cut(s) 391
PleI GAGTC 2 cut(s) 16, 32
PpsI GAGTC 2 cut(s) 16, 32
Psp6I CCWGG 1 cut(s) 391
PspGI CCWGG 1 cut(s) 391
PstI CTGCAG 1 cut(s) 68
RsaI GTAC 1 cut(s) 166
RsaNI GTAC 1 cut(s) 165
RseI CAYNNNNRTG 1 cut(s) 66
SaqAI TTAA 1 cut(s) 152
SchI GAGTC 2 cut(s) 17, 33
ScrFI CCNGG 1 cut(s) 393
SetI ASST 5 cut(s) 95, 189, 206, 270, 316
SfaNI GCATC 1 cut(s) 156
SfcI CTRYAG 1 cut(s) 64
SfuI TTCGAA 1 cut(s) 131
SmiMI CAYNNNNRTG 1 cut(s) 66
Sse9I AATT 2 cut(s) 37, 113
StyD4I CCNGG 1 cut(s) 391
TaqI TCGA 1 cut(s) 131
TasI AATT 2 cut(s) 37, 113
TfiI GAWTC 1 cut(s) 376
Tru1I TTAA 1 cut(s) 152
Tru9I TTAA 1 cut(s) 152
TscAI CASTG 3 cut(s) 68, 73, 331
TseFI GTSAC 1 cut(s) 77
Tsp45I GTSAC 1 cut(s) 77
TspDTI ATGAA 1 cut(s) 95
TspRI CASTG 3 cut(s) 68, 73, 331
XmiI GTMKAC 2 cut(s) 11, 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.