pycom04g21190

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
OG0000562
Physical Location & Seq
Forward (+)
22484918 .. 22485795
878 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g21190.3

Sequence Viewer

Length: 789 bp
ATGACTTGGGAAAGTGTGCATCAAATTTTCAATGGCAACGGCAAAGGCCTCAACTTGGAGGCCATGTGCTTGGCAAAGACATCAAAGAGTGGCGTGCGTAGGTGGATAACAGCTCAGCTGCTGTTGGTGTTTAGCTGTTGCTTTCGGTCCTCCATCATCTATTGTTTATCCATTGCTTTCGGCCCTTCTTCACTGTCATCATTATGTTGGCTTAGCTGCCATGGTCCTCCTTTCTTCTTCACGTTTTTTTCTTCTCCCATATATGTTGCATCGTGTAATGGTTTCAGATATGAAAAATACATCAAACATTCAACATGGTATCAGAGCGGGCATCATCCTGAGCCAGTTCTGTATATCGAACCTGCTGTGTTTATTTTTTCAAAAACAATGGCAGATGGAAGTATCATTGCTTCTTCATCTGGAAGCGCCTCTGAAATGGATATCAATCCAAACCAACGACTCAGTTCAGTATTATTGAATGAGTTTAATTATTTGCCATGGGCAAGGGCTGTTAGTCTTGCTTTCGGTGGAAGATCCAAACTCGGTTTCATCAATGGCAGTCAACCTGCACCAGATGCTTTTTCTCCAGAATATGGAGGGTGGCTATGTAAAGATCAACTGGTCATGTCATGGTTGTTAAATTCTATGGAAAGGAATATTGCTGAAATCTTCAGCTATTCCGAGTCGTCTCTCATCCTTTGGACCACCGTGAAGGAGATGTATGGAAATCAAAACAATGCAGCTCGCATCTTTCAACTCAAGAAGGATATCTCCAACATACAGCAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 Retrotran_gag_3

Protein Analysis

263

Amino Acids

29.38

Weight (kDa)

8.38

Isoelectric Point (pI)

53.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 370, 574
AccB7I CCANNNNNTGG 1 cut(s) 593
AccBSI CCGCTC 1 cut(s) 327
AciI CCGC 1 cut(s) 327
AclWI GGATC 1 cut(s) 528
AcsI RAATTY 2 cut(s) 24, 640
AcuI CTGAAG 1 cut(s) 655
AfiI CCNNNNNNNGG 2 cut(s) 55, 593
AgsI TTSAA 5 cut(s) 31, 312, 381, 478, 755
AjuI GAANNNNNNNTTGG 2 cut(s) 530, 562
AluBI AGCT 6 cut(s) 113, 118, 135, 216, 675, 743
AluI AGCT 6 cut(s) 113, 118, 135, 216, 675, 743
Alw26I GTCTC 1 cut(s) 693
AlwI GGATC 1 cut(s) 528
AlwNI CAGNNNCTG 1 cut(s) 121
AoxI GGCC 3 cut(s) 46, 60, 181
ApeKI GCWGC 3 cut(s) 118, 216, 740
ApoI RAATTY 2 cut(s) 24, 640
AspLEI GCGC 1 cut(s) 428
AspS9I GGNCC 4 cut(s) 147, 182, 224, 702
AvaII GGWCC 3 cut(s) 147, 224, 702
BarI GAAGNNNNNNTAC 2 cut(s) 394, 426
BbvI GCAGC 3 cut(s) 105, 203, 752
BccI CCATC 2 cut(s) 161, 389
BceAI ACGGC 1 cut(s) 55
BcoDI GTCTC 1 cut(s) 693
BfoI RGCGCY 1 cut(s) 429
BfuAI ACCTGC 2 cut(s) 370, 574
BisI GCNGC 3 cut(s) 119, 217, 741
BlpI GCTNAGC 2 cut(s) 114, 212
BlsI GCNGC 3 cut(s) 120, 218, 742
Bme18I GGWCC 3 cut(s) 147, 224, 702
BmgT120I GGNCC 4 cut(s) 147, 182, 224, 702
BmsI GCATC 5 cut(s) 28, 278, 340, 565, 756
BpmI CTGGAG 1 cut(s) 570
Bpu10I CCTNAGC 1 cut(s) 339
Bpu1102I GCTNAGC 2 cut(s) 114, 212
BpuEI CTTGAG 1 cut(s) 743
BsaBI GATNNNNATC 1 cut(s) 444
BsaJI CCNNGG 2 cut(s) 220, 497
BsaXI ACNNNNNCTCC 2 cut(s) 50, 80
Bsc4I CCNNNNNNNGG 2 cut(s) 55, 593
Bse1I ACTGG 2 cut(s) 344, 624
Bse3DI GCAATG 2 cut(s) 171, 405
Bse8I GATNNNNATC 1 cut(s) 444
BseDI CCNNGG 2 cut(s) 220, 497
BseGI GGATG 2 cut(s) 334, 693
BseJI GATNNNNATC 1 cut(s) 444
BseLI CCNNNNNNNGG 2 cut(s) 55, 593
BseMI GCAATG 2 cut(s) 171, 405
BseMII CTCAG 3 cut(s) 128, 330, 475
BseNI ACTGG 2 cut(s) 344, 624
BseXI GCAGC 3 cut(s) 105, 203, 752
BsgI GTGCAG 1 cut(s) 552
BshFI GGCC 3 cut(s) 48, 62, 183
BslI CCNNNNNNNGG 2 cut(s) 55, 593
BsmAI GTCTC 1 cut(s) 693
BsmBI CGTCTC 1 cut(s) 693
BsnI GGCC 3 cut(s) 48, 62, 183
Bsp143I GATC 2 cut(s) 533, 613
Bsp1720I GCTNAGC 2 cut(s) 114, 212
Bsp19I CCATGG 2 cut(s) 220, 497
BspACI CCGC 1 cut(s) 327
BspANI GGCC 3 cut(s) 48, 62, 183
BspCNI CTCAG 3 cut(s) 127, 331, 474
BspMI ACCTGC 2 cut(s) 370, 574
BspPI GGATC 1 cut(s) 528
BsrBI CCGCTC 1 cut(s) 327
BsrDI GCAATG 2 cut(s) 171, 405
BsrI ACTGG 2 cut(s) 344, 624
BssECI CCNNGG 2 cut(s) 220, 497
BssMI GATC 2 cut(s) 533, 613
BssT1I CCWWGG 2 cut(s) 220, 497
Bst4CI ACNGT 2 cut(s) 195, 709
BstAPI GCANNNNNTGC 1 cut(s) 575
BstC8I GCNNGC 3 cut(s) 95, 329, 745
BstDEI CTNAG 4 cut(s) 114, 212, 339, 461
BstDSI CCRYGG 2 cut(s) 220, 497
BstF5I GGATG 2 cut(s) 334, 693
BstH2I RGCGCY 1 cut(s) 429
BstHHI GCGC 1 cut(s) 428
BstKTI GATC 2 cut(s) 536, 616
BstMAI GTCTC 1 cut(s) 693
BstMBI GATC 2 cut(s) 533, 613
BstMWI GCNNNNNNNGC 1 cut(s) 575
BstV1I GCAGC 3 cut(s) 105, 203, 752
BstX2I RGATCY 1 cut(s) 533
BstXI CCANNNNNNTGG 1 cut(s) 70
BstYI RGATCY 1 cut(s) 533
BsuRI GGCC 3 cut(s) 48, 62, 183
BtgI CCRYGG 2 cut(s) 220, 497
BtsCI GGATG 2 cut(s) 334, 693
BtsIMutI CAGTG 1 cut(s) 191
BveI ACCTGC 2 cut(s) 370, 574
Cac8I GCNNGC 3 cut(s) 95, 329, 745
CaiI CAGNNNCTG 1 cut(s) 121
CfoI GCGC 1 cut(s) 428
Cfr13I GGNCC 4 cut(s) 147, 182, 224, 702
CviAII CATG 6 cut(s) 64, 221, 315, 498, 625, 630
DdeI CTNAG 4 cut(s) 114, 212, 339, 461
DpnI GATC 2 cut(s) 535, 615
DpnII GATC 2 cut(s) 533, 613
Eco130I CCWWGG 2 cut(s) 220, 497
Eco147I AGGCCT 1 cut(s) 48
Eco32I GATATC 2 cut(s) 442, 769
Eco47I GGWCC 3 cut(s) 147, 224, 702
Eco57I CTGAAG 1 cut(s) 655
EcoRV GATATC 2 cut(s) 442, 769
EcoT14I CCWWGG 2 cut(s) 220, 497
ErhI CCWWGG 2 cut(s) 220, 497
Esp3I CGTCTC 1 cut(s) 693
FaeI CATG 6 cut(s) 67, 224, 318, 501, 628, 633
FatI CATG 6 cut(s) 63, 220, 314, 497, 624, 629
FauI CCCGC 1 cut(s) 320
Fnu4HI GCNGC 3 cut(s) 119, 217, 741
FokI GGATG 2 cut(s) 321, 680
Fsp4HI GCNGC 3 cut(s) 119, 217, 741
GlaI GCGC 1 cut(s) 427
GluI GCNGC 3 cut(s) 119, 217, 741
GsuI CTGGAG 1 cut(s) 570
HaeII RGCGCY 1 cut(s) 429
HaeIII GGCC 3 cut(s) 48, 62, 183
HhaI GCGC 1 cut(s) 428
Hin1II CATG 6 cut(s) 67, 224, 318, 501, 628, 633
Hin6I GCGC 1 cut(s) 426
HinP1I GCGC 1 cut(s) 426
HincII GTYRAC 1 cut(s) 563
HindII GTYRAC 1 cut(s) 563
HinfI GANTC 2 cut(s) 459, 683
Hpy166II GTNNAC 1 cut(s) 563
Hpy188I TCNGA 4 cut(s) 287, 324, 433, 682
Hpy188III TCNNGA 4 cut(s) 338, 420, 587, 760
Hpy8I GTNNAC 1 cut(s) 563
HpyAV CCTTC 3 cut(s) 195, 706, 757
HpyCH4III ACNGT 2 cut(s) 195, 709
HpyCH4IV ACGT 1 cut(s) 242
HpyCH4V TGCA 4 cut(s) 19, 269, 569, 740
HpyF10VI GCNNNNNNNGC 1 cut(s) 575
HpyF3I CTNAG 4 cut(s) 114, 212, 339, 461
HpySE526I ACGT 1 cut(s) 242
Hsp92II CATG 6 cut(s) 67, 224, 318, 501, 628, 633
HspAI GCGC 1 cut(s) 426
Kzo9I GATC 2 cut(s) 533, 613
LpnPI CCDG 8 cut(s) 351, 357, 375, 405, 579, 585, 600, 605
Lsp1109I GCAGC 3 cut(s) 105, 203, 752
LweI GCATC 5 cut(s) 28, 278, 340, 565, 756
MaeII ACGT 1 cut(s) 242
MalI GATC 2 cut(s) 535, 615
MbiI CCGCTC 1 cut(s) 327
MboI GATC 2 cut(s) 533, 613
MboII GAAGA 7 cut(s) 180, 226, 229, 243, 405, 543, 661
MflI RGATCY 1 cut(s) 533
MluCI AATT 3 cut(s) 24, 487, 640
MlyI GAGTC 2 cut(s) 453, 692
MnlI CCTC 6 cut(s) 52, 59, 160, 237, 439, 590
MseI TTAA 2 cut(s) 486, 638
MslI CAYNNNNRTG 1 cut(s) 202
MspA1I CMGCKG 1 cut(s) 118
MwoI GCNNNNNNNGC 1 cut(s) 575
NcoI CCATGG 2 cut(s) 220, 497
NdeII GATC 2 cut(s) 533, 613
NlaIII CATG 6 cut(s) 67, 224, 318, 501, 628, 633
PceI AGGCCT 1 cut(s) 48
PflMI CCANNNNNTGG 1 cut(s) 593
PkrI GCNGC 3 cut(s) 120, 218, 742
PleI GAGTC 2 cut(s) 453, 691
PpsI GAGTC 2 cut(s) 453, 691
PspPI GGNCC 4 cut(s) 147, 182, 224, 702
PstNI CAGNNNCTG 1 cut(s) 121
PsuI RGATCY 1 cut(s) 533
PvuII CAGCTG 1 cut(s) 118
RseI CAYNNNNRTG 1 cut(s) 202
SaqAI TTAA 2 cut(s) 486, 638
SatI GCNGC 3 cut(s) 119, 217, 741
Sau3AI GATC 2 cut(s) 533, 613
Sau96I GGNCC 4 cut(s) 147, 182, 224, 702
SchI GAGTC 2 cut(s) 453, 692
SfaNI GCATC 5 cut(s) 28, 278, 340, 565, 756
SinI GGWCC 3 cut(s) 147, 224, 702
SmiMI CAYNNNNRTG 1 cut(s) 202
SmlI CTYRAG 1 cut(s) 758
SmoI CTYRAG 1 cut(s) 758
Sse9I AATT 3 cut(s) 24, 487, 640
SseBI AGGCCT 1 cut(s) 48
SsiI CCGC 1 cut(s) 327
SspI AATATT 1 cut(s) 658
StuI AGGCCT 1 cut(s) 48
StyI CCWWGG 2 cut(s) 220, 497
TaaI ACNGT 2 cut(s) 195, 709
TaiI ACGT 1 cut(s) 245
TaqI TCGA 1 cut(s) 357
TaqII GACCGA 1 cut(s) 135
TasI AATT 3 cut(s) 24, 487, 640
Tru1I TTAA 2 cut(s) 486, 638
Tru9I TTAA 2 cut(s) 486, 638
TscAI CASTG 1 cut(s) 198
TseI GCWGC 3 cut(s) 118, 216, 740
TspDTI ATGAA 3 cut(s) 306, 405, 538
TspRI CASTG 1 cut(s) 198
Van91I CCANNNNNTGG 1 cut(s) 593
VpaK11BI GGWCC 3 cut(s) 147, 224, 702
XapI RAATTY 2 cut(s) 24, 640
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.