pycom15g35170

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
35011203 .. 35011724
522 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g35170.1

Sequence Viewer

Length: 522 bp
ATGGCCATATCAATATCTCTTGCCCTTGGAGGAAGATCCAAACTTGGATTCGTCAATGGAAGTATTGAAGCACCTGACGTCGCATCGCCGGAGTATGAAGCATGGCTGTGCAAAGACCAGCTGGTCATGTCGTGGCTCCTCAACTCCATGGATCCTAAGCTATCTGAAATTTTCAGTTTTTCAGAATCCTCTAGTGCTCTTTGGAAGGCAGTCAAGGACATGTATGGAAATCAAAACAATGCTGCTCAAGTGTTCCAGCTTAAGAGGAATCTTGCAAGTCTTCAACAAGGTGATAAATCCTTTGTTCATCATCTCGGTTGCATGAAAAACATGTGGAACGAACTAGAAATGTATCGACCACACACTATCGATGCTGCCGTACTGTTAAAAAGGTCCGAGGAAGACAAAATCTTTCATTTGCTTGCAAGTTTGGGTTCTGAATATGAAGATCTTAGAAGCCATATTCTAATGAATCCCGAACTTCCATCATTTGCAAGTGTTTGCACTACTATCCAGCGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

174

Amino Acids

19.46

Weight (kDa)

5.71

Isoelectric Point (pI)

59.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotran_gag_3 PF14244 4 - 26 6.3e-06 gag-polypeptide of LTR copia-type
Retrotran_gag_2 PF14223 12 - 171 3.2e-12 gag-polypeptide of LTR copia-type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 122
AatII GACGTC 1 cut(s) 81
AclWI GGATC 3 cut(s) 30, 146, 159
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 168
AcyI GRCGYC 1 cut(s) 78
AfaI GTAC 1 cut(s) 381
AflII CTTAAG 1 cut(s) 260
AflIII ACRYGT 2 cut(s) 219, 330
AgsI TTSAA 2 cut(s) 68, 284
AjuI GAANNNNNNNTTGG 2 cut(s) 32, 64
AluBI AGCT 3 cut(s) 121, 160, 259
AluI AGCT 3 cut(s) 121, 160, 259
Alw21I GWGCWC 1 cut(s) 199
AlwI GGATC 3 cut(s) 30, 146, 159
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 2 cut(s) 242, 374
ApoI RAATTY 1 cut(s) 168
AspS9I GGNCC 1 cut(s) 393
AsuHPI GGTGA 1 cut(s) 302
AvaII GGWCC 1 cut(s) 393
BalI TGGCCA 1 cut(s) 5
BamHI GGATCC 1 cut(s) 151
BbsI GAAGAC 2 cut(s) 272, 408
Bbv12I GWGCWC 1 cut(s) 199
BbvI GCAGC 2 cut(s) 229, 361
BccI CCATC 1 cut(s) 493
BceAI ACGGC 1 cut(s) 362
BfaI CTAG 2 cut(s) 192, 344
BfrI CTTAAG 1 cut(s) 260
BglII AGATCT 1 cut(s) 448
BisI GCNGC 2 cut(s) 243, 375
BlsI GCNGC 2 cut(s) 244, 376
Bme18I GGWCC 1 cut(s) 393
BmgT120I GGNCC 1 cut(s) 393
BmiI GGNNCC 2 cut(s) 137, 153
BmsI GCATC 2 cut(s) 92, 361
BpiI GAAGAC 2 cut(s) 272, 408
Bpu10I CCTNAGC 1 cut(s) 156
BpuEI CTTGAG 1 cut(s) 231
Bsa29I ATCGAT 1 cut(s) 369
BsaHI GRCGYC 1 cut(s) 78
BsaJI CCNNGG 3 cut(s) 25, 147, 396
BseCI ATCGAT 1 cut(s) 369
BseDI CCNNGG 3 cut(s) 25, 147, 396
BseRI GAGGAG 1 cut(s) 128
BseXI GCAGC 2 cut(s) 229, 361
BshFI GGCC 1 cut(s) 5
BshVI ATCGAT 1 cut(s) 369
BsiHKAI GWGCWC 1 cut(s) 199
BsiSI CCGG 1 cut(s) 89
BsnI GGCC 1 cut(s) 5
Bsp1286I GDGCHC 1 cut(s) 199
Bsp143I GATC 3 cut(s) 35, 151, 448
Bsp19I CCATGG 1 cut(s) 147
BspANI GGCC 1 cut(s) 5
BspDI ATCGAT 1 cut(s) 369
BspLI GGNNCC 2 cut(s) 137, 153
BspPI GGATC 3 cut(s) 30, 146, 159
BspTI CTTAAG 1 cut(s) 260
BssECI CCNNGG 3 cut(s) 25, 147, 396
BssMI GATC 3 cut(s) 35, 151, 448
BssNI GRCGYC 1 cut(s) 78
BssT1I CCWWGG 2 cut(s) 25, 147
Bst4CI ACNGT 1 cut(s) 384
BstACI GRCGYC 1 cut(s) 78
BstAFI CTTAAG 1 cut(s) 260
BstC8I GCNNGC 1 cut(s) 423
BstDEI CTNAG 2 cut(s) 156, 452
BstDSI CCRYGG 1 cut(s) 147
BstKTI GATC 3 cut(s) 38, 154, 451
BstMBI GATC 3 cut(s) 35, 151, 448
BstNSI RCATGY 2 cut(s) 223, 334
BstV1I GCAGC 2 cut(s) 229, 361
BstV2I GAAGAC 2 cut(s) 272, 408
BstX2I RGATCY 3 cut(s) 35, 151, 448
BstYI RGATCY 3 cut(s) 35, 151, 448
Bsu15I ATCGAT 1 cut(s) 369
BsuRI GGCC 1 cut(s) 5
BsuTUI ATCGAT 1 cut(s) 369
BtgI CCRYGG 1 cut(s) 147
BtgZI GCGATG 1 cut(s) 69
Cac8I GCNNGC 1 cut(s) 423
Cfr13I GGNCC 1 cut(s) 393
ClaI ATCGAT 1 cut(s) 369
Csp6I GTAC 1 cut(s) 380
CviAII CATG 6 cut(s) 102, 127, 148, 220, 322, 331
CviJI RGCY 7 cut(s) 5, 106, 121, 136, 160, 259, 459
CviKI_1 RGCY 7 cut(s) 5, 106, 121, 136, 160, 259, 459
CviQI GTAC 1 cut(s) 380
DdeI CTNAG 2 cut(s) 156, 452
DpnI GATC 3 cut(s) 37, 153, 450
DpnII GATC 3 cut(s) 35, 151, 448
DrdI GACNNNNNNGTC 1 cut(s) 122
DseDI GACNNNNNNGTC 1 cut(s) 122
EaeI YGGCCR 1 cut(s) 3
Eco130I CCWWGG 2 cut(s) 25, 147
Eco47I GGWCC 1 cut(s) 393
EcoT14I CCWWGG 2 cut(s) 25, 147
ErhI CCWWGG 2 cut(s) 25, 147
FaeI CATG 6 cut(s) 105, 130, 151, 223, 325, 334
FatI CATG 6 cut(s) 101, 126, 147, 219, 321, 330
Fnu4HI GCNGC 2 cut(s) 243, 375
Fsp4HI GCNGC 2 cut(s) 243, 375
FspBI CTAG 2 cut(s) 192, 344
GluI GCNGC 2 cut(s) 243, 375
HaeIII GGCC 1 cut(s) 5
HapII CCGG 1 cut(s) 89
Hin1I GRCGYC 1 cut(s) 78
Hin1II CATG 6 cut(s) 105, 130, 151, 223, 325, 334
HinfI GANTC 4 cut(s) 48, 185, 268, 472
HpaII CCGG 1 cut(s) 89
HphI GGTGA 1 cut(s) 302
Hpy188I TCNGA 4 cut(s) 166, 184, 397, 439
Hpy188III TCNNGA 1 cut(s) 476
Hpy99I CGWCG 1 cut(s) 83
HpyAV CCTTC 1 cut(s) 199
HpyCH4III ACNGT 1 cut(s) 384
HpyCH4IV ACGT 1 cut(s) 78
HpyCH4V TGCA 6 cut(s) 111, 275, 321, 425, 494, 504
HpyF3I CTNAG 2 cut(s) 156, 452
HpySE526I ACGT 1 cut(s) 78
Hsp92I GRCGYC 1 cut(s) 78
Hsp92II CATG 6 cut(s) 105, 130, 151, 223, 325, 334
Kzo9I GATC 3 cut(s) 35, 151, 448
LmnI GCTCC 1 cut(s) 141
LpnPI CCDG 5 cut(s) 87, 102, 107, 131, 269
Lsp1109I GCAGC 2 cut(s) 229, 361
LweI GCATC 2 cut(s) 92, 361
MaeI CTAG 2 cut(s) 192, 344
MaeII ACGT 1 cut(s) 78
MalI GATC 3 cut(s) 37, 153, 450
MboI GATC 3 cut(s) 35, 151, 448
MboII GAAGA 4 cut(s) 45, 272, 413, 458
MflI RGATCY 3 cut(s) 35, 151, 448
MhlI GDGCHC 1 cut(s) 199
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 1 cut(s) 168
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 5 cut(s) 23, 149, 199, 258, 391
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 2 cut(s) 261, 386
MslI CAYNNNNRTG 1 cut(s) 106
Msp20I TGGCCA 1 cut(s) 5
MspA1I CMGCKG 1 cut(s) 121
MspCI CTTAAG 1 cut(s) 260
MspI CCGG 1 cut(s) 89
NcoI CCATGG 1 cut(s) 147
NdeII GATC 3 cut(s) 35, 151, 448
NlaIII CATG 6 cut(s) 105, 130, 151, 223, 325, 334
NlaIV GGNNCC 2 cut(s) 137, 153
NspI RCATGY 2 cut(s) 223, 334
PciI ACATGT 2 cut(s) 219, 330
PcsI WCGNNNNNNNCGW 1 cut(s) 375
PfeI GAWTC 4 cut(s) 48, 185, 268, 472
PkrI GCNGC 2 cut(s) 244, 376
PscI ACATGT 2 cut(s) 219, 330
PspN4I GGNNCC 2 cut(s) 137, 153
PspPI GGNCC 1 cut(s) 393
PsuI RGATCY 3 cut(s) 35, 151, 448
PvuII CAGCTG 1 cut(s) 121
RsaI GTAC 1 cut(s) 381
RsaNI GTAC 1 cut(s) 380
RseI CAYNNNNRTG 1 cut(s) 106
SaqAI TTAA 2 cut(s) 261, 386
SatI GCNGC 2 cut(s) 243, 375
Sau3AI GATC 3 cut(s) 35, 151, 448
Sau96I GGNCC 1 cut(s) 393
SduI GDGCHC 1 cut(s) 199
SetI ASST 7 cut(s) 76, 81, 123, 162, 261, 292, 395
SfaNI GCATC 2 cut(s) 92, 361
SinI GGWCC 1 cut(s) 393
SmiMI CAYNNNNRTG 1 cut(s) 106
SmlI CTYRAG 2 cut(s) 246, 260
SmoI CTYRAG 2 cut(s) 246, 260
Sse9I AATT 1 cut(s) 168
SspMI CTAG 2 cut(s) 192, 344
StyI CCWWGG 2 cut(s) 25, 147
TaaI ACNGT 1 cut(s) 384
TaiI ACGT 1 cut(s) 81
TaqI TCGA 2 cut(s) 355, 369
TasI AATT 1 cut(s) 168
TfiI GAWTC 4 cut(s) 48, 185, 268, 472
Tru1I TTAA 2 cut(s) 261, 386
Tru9I TTAA 2 cut(s) 261, 386
TseI GCWGC 2 cut(s) 242, 374
TspDTI ATGAA 6 cut(s) 111, 296, 338, 404, 459, 485
Vha464I CTTAAG 1 cut(s) 260
VpaK11BI GGWCC 1 cut(s) 393
XapI RAATTY 1 cut(s) 168
XceI RCATGY 2 cut(s) 223, 334
XspI CTAG 2 cut(s) 192, 344
ZraI GACGTC 1 cut(s) 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.