Rroxscaffold_7G00189230

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0000562
Physical Location & Seq
Reverse (-)
28964461 .. 28966553
2093 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00189230.1

Sequence Viewer

Length: 279 bp
ATGGCTGGGAAATCTGGTTCTAAAACTGATAAACCACTTGCAAACTCTTTCGACGTCGAGTTTAATCCAAACCAACATCTTAGCTCTGTTTTGTTTAATGAATTCAACTATCTTTCTTGGGCCAGAACTGTTACACTTGCTCTTGGAGGAAGGTCCAAGCTTGGCTATGTCAATGGAGTTATACGAAGCCTAAAGCTAACTCCTCTACATATGATTCTTGGTCGTGTAAGGATCAACTCTTTACGTCTTGGCTGCACAACTCTATGGAGAGCAGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 Retrotran_gag_3 rve

Protein Analysis

92

Amino Acids

10.24

Weight (kDa)

10.36

Isoelectric Point (pI)

24.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotran_gag_3 PF14244 27 - 61 4.6e-12 gag-polypeptide of LTR copia-type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 57
AclWI GGATC 1 cut(s) 239
AcsI RAATTY 1 cut(s) 101
AcyI GRCGYC 1 cut(s) 54
AgsI TTSAA 1 cut(s) 106
AloI GAACNNNNNNTCC 1 cut(s) 33
AluBI AGCT 3 cut(s) 84, 160, 196
AluI AGCT 3 cut(s) 84, 160, 196
AlwI GGATC 1 cut(s) 239
AoxI GGCC 1 cut(s) 120
ApeKI GCWGC 1 cut(s) 252
ApoI RAATTY 1 cut(s) 101
AspS9I GGNCC 2 cut(s) 120, 153
AvaII GGWCC 1 cut(s) 153
BbvI GCAGC 1 cut(s) 239
BisI GCNGC 1 cut(s) 253
BlsI GCNGC 1 cut(s) 254
Bme18I GGWCC 1 cut(s) 153
BmgT120I GGNCC 2 cut(s) 120, 153
BsaHI GRCGYC 1 cut(s) 54
BseRI GAGGAG 1 cut(s) 192
BseXI GCAGC 1 cut(s) 239
BseYI CCCAGC 1 cut(s) 5
BsgI GTGCAG 1 cut(s) 238
BshFI GGCC 1 cut(s) 122
BsnI GGCC 1 cut(s) 122
Bsp143I GATC 1 cut(s) 231
BspANI GGCC 1 cut(s) 122
BspPI GGATC 1 cut(s) 239
BssMI GATC 1 cut(s) 231
BssNI GRCGYC 1 cut(s) 54
Bst4CI ACNGT 1 cut(s) 130
BstACI GRCGYC 1 cut(s) 54
BstDEI CTNAG 1 cut(s) 80
BstKTI GATC 1 cut(s) 234
BstMBI GATC 1 cut(s) 231
BstV1I GCAGC 1 cut(s) 239
BsuRI GGCC 1 cut(s) 122
Cfr13I GGNCC 2 cut(s) 120, 153
CviJI RGCY 8 cut(s) 5, 84, 122, 160, 165, 189, 196, 252
CviKI_1 RGCY 8 cut(s) 5, 84, 122, 160, 165, 189, 196, 252
DdeI CTNAG 1 cut(s) 80
DpnI GATC 1 cut(s) 233
DpnII GATC 1 cut(s) 231
Eco47I GGWCC 1 cut(s) 153
EcoRI GAATTC 1 cut(s) 101
FaiI YATR 5 cut(s) 168, 182, 210, 212, 265
FauNDI CATATG 1 cut(s) 210
Fnu4HI GCNGC 1 cut(s) 253
Fsp4HI GCNGC 1 cut(s) 253
GluI GCNGC 1 cut(s) 253
GsaI CCCAGC 1 cut(s) 9
HaeIII GGCC 1 cut(s) 122
Hin1I GRCGYC 1 cut(s) 54
HindIII AAGCTT 1 cut(s) 158
HinfI GANTC 1 cut(s) 214
Hpy99I CGWCG 2 cut(s) 56, 59
HpyAV CCTTC 1 cut(s) 144
HpyCH4III ACNGT 1 cut(s) 130
HpyCH4IV ACGT 2 cut(s) 54, 244
HpyCH4V TGCA 2 cut(s) 41, 255
HpyF3I CTNAG 1 cut(s) 80
HpySE526I ACGT 2 cut(s) 54, 244
Hsp92I GRCGYC 1 cut(s) 54
Kzo9I GATC 1 cut(s) 231
LpnPI CCDG 1 cut(s) 136
Lsp1109I GCAGC 1 cut(s) 239
MaeII ACGT 2 cut(s) 54, 244
MaeIII GTNAC 1 cut(s) 130
MalI GATC 1 cut(s) 233
MboI GATC 1 cut(s) 231
MluCI AATT 1 cut(s) 101
MnlI CCTC 2 cut(s) 140, 213
MseI TTAA 2 cut(s) 63, 96
NdeI CATATG 1 cut(s) 210
NdeII GATC 1 cut(s) 231
PfeI GAWTC 1 cut(s) 214
PkrI GCNGC 1 cut(s) 254
PspFI CCCAGC 1 cut(s) 5
PspPI GGNCC 2 cut(s) 120, 153
SaqAI TTAA 2 cut(s) 63, 96
SatI GCNGC 1 cut(s) 253
Sau3AI GATC 1 cut(s) 231
Sau96I GGNCC 2 cut(s) 120, 153
SetI ASST 6 cut(s) 57, 86, 155, 162, 198, 247
SinI GGWCC 1 cut(s) 153
Sse9I AATT 1 cut(s) 101
TaaI ACNGT 1 cut(s) 130
TaiI ACGT 2 cut(s) 57, 247
TaqI TCGA 2 cut(s) 51, 57
TasI AATT 1 cut(s) 101
TfiI GAWTC 1 cut(s) 214
Tru1I TTAA 2 cut(s) 63, 96
Tru9I TTAA 2 cut(s) 63, 96
TseI GCWGC 1 cut(s) 252
TspDTI ATGAA 1 cut(s) 114
VpaK11BI GGWCC 1 cut(s) 153
XapI RAATTY 1 cut(s) 101
ZraI GACGTC 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.