Prupe.3G136000_v2.0.a1

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
OG0000562
Physical Location & Seq
Reverse (-)
14365411 .. 14366298
888 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G136000.1

Sequence Viewer

Length: 495 bp
ATGGCCAAGGAAAAAAGGAACATGGACGAGGCTTGTAGTGGTAATGGAAAATCAAGAGCCGTCAATTTGGCTCTTGGAGGAAGAGAGAAACTTGGTTTCATCAATGGAAATATTCCCGCACCTGTTGTTGATGATCCAAAGTATGAGGATTGGTTTTGCAAGGATCAACTTGTCATGTCTTGGTTGCTCAACTCTATGGAGCCTGAGGTTGCTGAGATTTTCAGTTTTTCTAATTTTGCACAACATCTTTGGACTGCTGCCAAAGAAATGTATGGAAATAAAAATATTGCAGCCATGATTTTTCAACTAAAGAAGGATATTGCTGGGGTGTACCAAGATGGAAAATCTTTTATTGAATACATGAGAAAGCTTAAAGGCATGTGGAATGAGCTAGATCTTTACAGACCTCATACTACTAATTTAGTCAATCTTCTAAAAAGGGCTGAAGAGGATAAAATTTTTGTAGAGTTAAACTCAAAATCCAAATACAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 Retrotran_gag_3

Protein Analysis

165

Amino Acids

18.89

Weight (kDa)

8.44

Isoelectric Point (pI)

36.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 117
AclWI GGATC 2 cut(s) 128, 171
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 456
AcuI CTGAAG 1 cut(s) 465
AfaI GTAC 1 cut(s) 332
AfiI CCNNNNNNNGG 1 cut(s) 489
AgsI TTSAA 2 cut(s) 305, 356
AluBI AGCT 2 cut(s) 370, 391
AluI AGCT 2 cut(s) 370, 391
AlwI GGATC 2 cut(s) 128, 171
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 2 cut(s) 257, 290
ApoI RAATTY 1 cut(s) 456
AxyI CCTNAGG 1 cut(s) 204
BalI TGGCCA 1 cut(s) 5
BbvI GCAGC 2 cut(s) 244, 302
BccI CCATC 1 cut(s) 332
BceAI ACGGC 1 cut(s) 44
BfaI CTAG 1 cut(s) 392
BglII AGATCT 1 cut(s) 394
BisI GCNGC 2 cut(s) 258, 291
BlsI GCNGC 2 cut(s) 259, 292
BmiI GGNNCC 1 cut(s) 201
BplI GAGNNNNNCTC 2 cut(s) 458, 490
BsaJI CCNNGG 1 cut(s) 6
Bsc4I CCNNNNNNNGG 1 cut(s) 489
Bse21I CCTNAGG 1 cut(s) 204
BseDI CCNNGG 1 cut(s) 6
BseLI CCNNNNNNNGG 1 cut(s) 489
BseMII CTCAG 2 cut(s) 195, 204
BseXI GCAGC 2 cut(s) 244, 302
BseYI CCCAGC 1 cut(s) 323
BshFI GGCC 1 cut(s) 5
BslI CCNNNNNNNGG 1 cut(s) 489
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 3 cut(s) 133, 163, 394
BspACI CCGC 1 cut(s) 117
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 2 cut(s) 196, 205
BspLI GGNNCC 1 cut(s) 201
BspPI GGATC 2 cut(s) 128, 171
BssECI CCNNGG 1 cut(s) 6
BssMI GATC 3 cut(s) 133, 163, 394
BssT1I CCWWGG 1 cut(s) 6
Bst6I CTCTTC 2 cut(s) 76, 441
BstDEI CTNAG 2 cut(s) 204, 213
BstKTI GATC 3 cut(s) 136, 166, 397
BstMBI GATC 3 cut(s) 133, 163, 394
BstNSI RCATGY 1 cut(s) 382
BstV1I GCAGC 2 cut(s) 244, 302
BstX2I RGATCY 1 cut(s) 394
BstYI RGATCY 1 cut(s) 394
Bsu36I CCTNAGG 1 cut(s) 204
BsuRI GGCC 1 cut(s) 5
Csp6I GTAC 1 cut(s) 331
CviAII CATG 5 cut(s) 22, 175, 295, 361, 379
CviJI RGCY 9 cut(s) 5, 32, 59, 71, 202, 293, 370, 391, 443
CviKI_1 RGCY 9 cut(s) 5, 32, 59, 71, 202, 293, 370, 391, 443
CviQI GTAC 1 cut(s) 331
DdeI CTNAG 2 cut(s) 204, 213
DpnI GATC 3 cut(s) 135, 165, 396
DpnII GATC 3 cut(s) 133, 163, 394
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 2 cut(s) 76, 441
EarI CTCTTC 2 cut(s) 76, 441
Eco130I CCWWGG 1 cut(s) 6
Eco57I CTGAAG 1 cut(s) 465
Eco81I CCTNAGG 1 cut(s) 204
EcoT14I CCWWGG 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 6
FaeI CATG 5 cut(s) 25, 178, 298, 364, 382
FaiI YATR 9 cut(s) 23, 144, 176, 197, 273, 296, 362, 380, 411
FatI CATG 5 cut(s) 21, 174, 294, 360, 378
FauI CCCGC 1 cut(s) 124
Fnu4HI GCNGC 2 cut(s) 258, 291
Fsp4HI GCNGC 2 cut(s) 258, 291
FspBI CTAG 1 cut(s) 392
GluI GCNGC 2 cut(s) 258, 291
GsaI CCCAGC 1 cut(s) 327
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 5 cut(s) 25, 178, 298, 364, 382
HindIII AAGCTT 1 cut(s) 368
Hpy166II GTNNAC 1 cut(s) 331
Hpy188III TCNNGA 1 cut(s) 54
Hpy8I GTNNAC 1 cut(s) 331
HpyAV CCTTC 1 cut(s) 307
HpyCH4V TGCA 3 cut(s) 159, 239, 290
HpyF3I CTNAG 2 cut(s) 204, 213
Hsp92II CATG 5 cut(s) 25, 178, 298, 364, 382
Kzo9I GATC 3 cut(s) 133, 163, 394
LmnI GCTCC 1 cut(s) 199
LpnPI CCDG 4 cut(s) 135, 216, 309, 475
Lsp1109I GCAGC 2 cut(s) 244, 302
MaeI CTAG 1 cut(s) 392
MalI GATC 3 cut(s) 135, 165, 396
MboI GATC 3 cut(s) 133, 163, 394
MboII GAAGA 3 cut(s) 93, 422, 458
MflI RGATCY 1 cut(s) 394
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 4 cut(s) 64, 232, 418, 456
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 6 cut(s) 22, 71, 139, 199, 417, 442
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 2 cut(s) 372, 470
Msp20I TGGCCA 1 cut(s) 5
NdeII GATC 3 cut(s) 133, 163, 394
NlaIII CATG 5 cut(s) 25, 178, 298, 364, 382
NlaIV GGNNCC 1 cut(s) 201
NspI RCATGY 1 cut(s) 382
PkrI GCNGC 2 cut(s) 259, 292
PspFI CCCAGC 1 cut(s) 323
PspN4I GGNNCC 1 cut(s) 201
PsuI RGATCY 1 cut(s) 394
RsaI GTAC 1 cut(s) 332
RsaNI GTAC 1 cut(s) 331
SaqAI TTAA 2 cut(s) 372, 470
SatI GCNGC 2 cut(s) 258, 291
Sau3AI GATC 3 cut(s) 133, 163, 394
SetI ASST 6 cut(s) 124, 210, 372, 393, 409, 494
Sse9I AATT 4 cut(s) 64, 232, 418, 456
SsiI CCGC 1 cut(s) 117
SspI AATATT 2 cut(s) 112, 286
SspMI CTAG 1 cut(s) 392
StyI CCWWGG 1 cut(s) 6
TasI AATT 4 cut(s) 64, 232, 418, 456
Tru1I TTAA 2 cut(s) 372, 470
Tru9I TTAA 2 cut(s) 372, 470
TseI GCWGC 2 cut(s) 257, 290
TspDTI ATGAA 1 cut(s) 88
XapI RAATTY 1 cut(s) 456
XceI RCATGY 1 cut(s) 382
XspI CTAG 1 cut(s) 392
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.