Rmu_ssc0000019.1_g000029

gag-polypeptide of LTR copia-type

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000019.1
OG0000562
Physical Location & Seq
Reverse (-)
140507 .. 140890
384 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000019.1_g000029.1.cds

Sequence Viewer

Length: 384 bp
atgaaagtttgttatccaaagaccaacttgttatgtcatggctccttaattcaatggagccaaaacaatgcagcaagagtgttccaactcagaaaggatcttgcagggattcaacaaggtaatctctcatttgttcaacatcttggcaacctaaaagctaagtggaatgaacttgatatgtatagacctcacaccactgatgccaccatattgctgaaaagagctgaagaagataaagtgttccacggtctgaacctggaaattgacatgaatatgaagaatgttaggattcaatcagattctctcaacctaattgctgatttgaattcaaatggaaaatacttgaattggagagcttcccagattattgatgaaatcaattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00940 ko01110 map00940 map01110
Pfam Domains
Protein Families
Retrotran_gag_2

Protein Analysis

127

Amino Acids

14.62

Weight (kDa)

8.6

Isoelectric Point (pI)

26.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000562)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17331 FvH4_3g36541
malus_domestica MD07G1078600.v1.1 MD10G1237700.v1.1 MD10G1333400.v1.1 MD11G1102200.v1.1 MD13G1138400.v1.1 MD14G1033400.v1.1 MD15G1053300.v1.1
prunus_persica Prupe.1G465400_v2.0.a1 Prupe.3G136000_v2.0.a1 Prupe.7G119900_v2.0.a1
pyrus_communis pycom01g04630 pycom03g13050 pycom04g21190 pycom05g04910 pycom05g05510 pycom08g15850 pycom09g15040 pycom1094g00010 pycom11g02000 pycom12g06150 pycom13g24110 pycom13g24910 pycom14g00050 pycom15g21970 pycom15g35170 pycom15g35180 pycom16g14620 pycom16g14630 pycom808g00110
rosa_chinensis RchiOBHm_Chr1g0322851 RchiOBHm_Chr1g0365941 RchiOBHm_Chr3g0453341 RchiOBHm_Chr4g0388371 RchiOBHm_Chr4g0394021 RchiOBHm_Chr5g0013181 RchiOBHm_Chr6g0261721 RchiOBHm_Chr6g0261731 RchiOBHm_Chr7g0188861 RchiOBHm_Chr7g0192331 RchiOBHm_Chr7g0231721
rosa_multiflora Rmu_sc0002521.1_g000006 Rmu_sc0003255.1_g000026 Rmu_sc0004191.1_g000036 Rmu_sc0004414.1_g000014 Rmu_sc0005670.1_g000006 Rmu_sc0006081.1_g000001 Rmu_sc0007215.1_g000004 Rmu_sc0010088.1_g000010 Rmu_sc0020285.1_g000003 Rmu_sc0026896.1_g000002 Rmu_ssc0000019.1_g000029
rosa_roxburghii Rroxscaffold_3G00224890 Rroxscaffold_6G00400640 Rroxscaffold_7G00176590 Rroxscaffold_7G00189230
rosa_samantha Rh4BG046700
rosa_wichuraiana Rw1G012690 Rw1G031370 Rw2G042180 Rw2G043670 Rw2G046240 Rw2G049890 Rw2G050760 Rw2G051280 Rw2G053590 Rw3G007590 Rw3G026850 Rw4G001540 Rw4G009760 Rw4G019270 Rw5G000720 Rw5G005620 Rw5G041560 Rw6G007370 Rw6G009830 Rw6G015360 Rw6G031160 Rw7G004930 Rw7G011010 Rw7G024230 Rw7G028240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 105
AcsI RAATTY 1 cut(s) 325
AcuI CTGAAG 1 cut(s) 246
AgsI TTSAA 7 cut(s) 53, 113, 137, 293, 325, 330, 346
AjnI CCWGG 1 cut(s) 255
AluBI AGCT 3 cut(s) 158, 224, 356
AluI AGCT 3 cut(s) 158, 224, 356
AlwI GGATC 1 cut(s) 105
ApeKI GCWGC 1 cut(s) 71
ApoI RAATTY 1 cut(s) 325
BbvI GCAGC 1 cut(s) 83
BciT130I CCWGG 1 cut(s) 257
BisI GCNGC 1 cut(s) 72
BlsI GCNGC 1 cut(s) 73
Bme1390I CCNGG 1 cut(s) 257
BmiI GGNNCC 2 cut(s) 43, 59
BmrFI CCNGG 1 cut(s) 257
BmsI GCATC 1 cut(s) 190
BsaJI CCNNGG 1 cut(s) 244
BseBI CCWGG 1 cut(s) 257
BseDI CCNNGG 1 cut(s) 244
BseMII CTCAG 1 cut(s) 103
BseXI GCAGC 1 cut(s) 83
Bsp143I GATC 1 cut(s) 97
BspCNI CTCAG 1 cut(s) 102
BspLI GGNNCC 2 cut(s) 43, 59
BspPI GGATC 1 cut(s) 105
BssECI CCNNGG 1 cut(s) 244
BssMI GATC 1 cut(s) 97
Bst2UI CCWGG 1 cut(s) 257
Bst4CI ACNGT 1 cut(s) 248
BstDEI CTNAG 2 cut(s) 89, 159
BstDSI CCRYGG 1 cut(s) 244
BstKTI GATC 1 cut(s) 100
BstMBI GATC 1 cut(s) 97
BstNI CCWGG 1 cut(s) 257
BstSCI CCNGG 1 cut(s) 255
BstV1I GCAGC 1 cut(s) 83
BstX2I RGATCY 1 cut(s) 97
BstYI RGATCY 1 cut(s) 97
BtgI CCRYGG 1 cut(s) 244
BtsIMutI CAGTG 1 cut(s) 195
CviAII CATG 2 cut(s) 38, 268
CviJI RGCY 5 cut(s) 42, 60, 158, 224, 356
CviKI_1 RGCY 5 cut(s) 42, 60, 158, 224, 356
DdeI CTNAG 2 cut(s) 89, 159
DpnI GATC 1 cut(s) 99
DpnII GATC 1 cut(s) 97
Eco57I CTGAAG 1 cut(s) 246
EcoRI GAATTC 1 cut(s) 325
EcoRII CCWGG 1 cut(s) 255
FaeI CATG 2 cut(s) 41, 271
FaiI YATR 7 cut(s) 34, 39, 179, 183, 209, 269, 275
FalI AAGNNNNNCTT 2 cut(s) 11, 43
FatI CATG 2 cut(s) 37, 267
Fnu4HI GCNGC 1 cut(s) 72
Fsp4HI GCNGC 1 cut(s) 72
GluI GCNGC 1 cut(s) 72
Hin1II CATG 2 cut(s) 41, 271
HinfI GANTC 3 cut(s) 109, 289, 299
Hpy188I TCNGA 3 cut(s) 92, 252, 298
HpyCH4III ACNGT 1 cut(s) 248
HpyCH4V TGCA 2 cut(s) 71, 104
HpyF3I CTNAG 2 cut(s) 89, 159
Hsp92II CATG 2 cut(s) 41, 271
Kzo9I GATC 1 cut(s) 97
LmnI GCTCC 2 cut(s) 47, 57
LpnPI CCDG 4 cut(s) 90, 242, 269, 374
Lsp1109I GCAGC 1 cut(s) 83
LweI GCATC 1 cut(s) 190
MalI GATC 1 cut(s) 99
MboI GATC 1 cut(s) 97
MboII GAAGA 3 cut(s) 239, 242, 289
MflI RGATCY 1 cut(s) 97
MluCI AATT 6 cut(s) 48, 261, 312, 325, 346, 379
MmeI TCCRAC 1 cut(s) 109
MnlI CCTC 1 cut(s) 198
MseI TTAA 1 cut(s) 47
MslI CAYNNNNRTG 1 cut(s) 272
MspR9I CCNGG 1 cut(s) 257
MvaI CCWGG 1 cut(s) 257
NdeII GATC 1 cut(s) 97
NlaIII CATG 2 cut(s) 41, 271
NlaIV GGNNCC 2 cut(s) 43, 59
PfeI GAWTC 3 cut(s) 109, 289, 299
PkrI GCNGC 1 cut(s) 73
Psp6I CCWGG 1 cut(s) 255
PspGI CCWGG 1 cut(s) 255
PspN4I GGNNCC 2 cut(s) 43, 59
PsuI RGATCY 1 cut(s) 97
RseI CAYNNNNRTG 1 cut(s) 272
SaqAI TTAA 1 cut(s) 47
SatI GCNGC 1 cut(s) 72
Sau3AI GATC 1 cut(s) 97
ScrFI CCNGG 1 cut(s) 257
SetI ASST 8 cut(s) 121, 153, 160, 190, 226, 258, 312, 358
SfaNI GCATC 1 cut(s) 190
SmiMI CAYNNNNRTG 1 cut(s) 272
Sse9I AATT 6 cut(s) 48, 261, 312, 325, 346, 379
StyD4I CCNGG 1 cut(s) 255
TaaI ACNGT 1 cut(s) 248
TasI AATT 6 cut(s) 48, 261, 312, 325, 346, 379
TfiI GAWTC 3 cut(s) 109, 289, 299
Tru1I TTAA 1 cut(s) 47
Tru9I TTAA 1 cut(s) 47
TscAI CASTG 1 cut(s) 202
TseI GCWGC 1 cut(s) 71
TspDTI ATGAA 4 cut(s) 17, 183, 284, 290
TspRI CASTG 1 cut(s) 202
XapI RAATTY 1 cut(s) 325
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.